Gene RGS19 Variant 1
DNA : 6.33 KbNT_011333
mRNA : 1569 bp NM_005873
CDS : 654 bp NP_005864
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  219 bp
ggggagggggcgccgcagccgggttcccctttttctggagctcaaagcctggggaagtga
ttgctcaaaggtgggggccggaagaacccaggtttccgcgtctccctccccctctcagcc
cggtgaggaggggccggggcgggacaccctgtccgcccccgcccccaccccgctggatct
GGCAGCCACTCAGCCCTTCGAGCTGTAGGGGAGGCGCTGCGCCCCCGGCCCCAGCCGATC
GGGGGCTCCTGGCGCTAGCCTCCCTCCAGAGCGCCGCAGGAGTCCCTCCTGCCGTCTGAC
TTGAGTCCCTGCTGCTGCAGTGCACGCCCCTTCGGCAGCCAGGGTGGGGCCCAGACCCAA
CCTGGCCCCTCCTGCCCCCACCCCGCCTTTGGGTCGCTG
gtgagtagggagctttgaggtaggggtgggggcgtcagaggctgaagaaagaggcacctg
gaggagaacacaggcttctccagactggaccctaacagcagagagaggagcgtggtgggt
gggccaccaccaccatttcagaggtggggagagctggccttccctggaggggccaggcca
EXON 2  98 bp
tcctggaccccctcccagccctgctgtaagcttggggtcggggtagaagccctaggcaga
gctgggtccagaggcaggagcaggccccgctagggagacaccctctcaggacccctccta
aggggtaggcaggggctggggtttcaggttctcagtcagaaccttggcccctctccccag
ACCCCCAGGCTGTGGTGAGGGTCTGAGAGCTGGTACCACGGAGCCTGGGCAACCTCCTCC
GCCCACCCATGCCCACCCCGCATGAGGCTGAGAAGCAG
gtatgccacctccccctctgcctctgctcccctgggggagatggggtggggcaagctgag
gggccacaaggagctgggagatccctgaacacccgggaggccagaagggtcatgtgcctg
ggaacagggctacccatgggaaggtgggggagaggtggagagtctggtgggttctgacct
EXON 3  122 bp
cctgggggagatggggtggggcaagctgaggggccacaaggagctgggagatccctgaac
acccgggaggccagaagggtcatgtgcctgggaacagggctacccatgggaaggtggggg
agaggtggagagtctggtgggttctgacctgaaagctgaggtagccccacttttccccag
ATCACAGGGCCAGAGGAGGCGGACCGGCCCCCTTCAATGTCCAGTCATGATACAGCCTCT
CCAGCGGCCCCCAGCCGCAACCCCTGCTGCCTGTGCTGGTGCTGCTGCTGTAGCTGCTCC
TG
gtgagtagggcctggggtgcccagctggcgagggggtcgagggcatggggccaagcagac
ccaggaggggacccagtggtggcttccgaggcatccccgcaggcaggatgcccctgccac
ctcacagcactgtcctgtccagggtctgttgggccctggtgatgagtggccggtgccttg
EXON 4  75 bp
aagagccagctccaggggctgccctcctgcagtgggtgcccatgtgtgtcaggtgcctgc
aggggctgccctcctgcagtgggtgcccatgtgtgtcaggtgcctgcccatgtgctgagg
gcctgtgtggccgtggaggcgtgtgtgcccacggcagcgctgcttcctctctgccactag
GAACCAAGAGCGGCGGCGCGCGTGGCAGGCCTCCCGGGAGAGCAAGCTGCAGCCCCTCCC
CAGCTGTGAAGTATG
gtgagtccagccggctggtgtgtgcgtgctgggggggccccagaccgggagactcgggcc
tgacatagcctggcccccgtgcccacagtgccacgccaagtcctgaggaggtgcagagct
gggcgcagtcttttgacaagctgatgcacagcccagcgggacgcagcgtgttccgggcgt
EXON 5  235 bp
ttcctctctgccactaggaaccaagagcggcggcgcgcgtggcaggcctcccgggagagc
aagctgcagcccctccccagctgtgaagtatggtgagtccagccggctggtgtgtgcgtg
ctgggggggccccagaccgggagactcgggcctgacatagcctggcccccgtgcccacag
TGCCACGCCAAGTCCTGAGGAGGTGCAGAGCTGGGCGCAGTCTTTTGACAAGCTGATGCA
CAGCCCAGCGGGACGCAGCGTGTTCCGGGCGTTCCTGCGGACAGAGTACAGCGAGGAGAA
CATGCTCTTCTGGTTGGCCTGCGAGGAGCTGAAGGCCGAGGCCAACCAGCATGTGGTAGA
CGAGAAGGCGAGGCTCATCTACGAGGACTACGTATCCATCCTGTCCCCCAAGGAG
gtgcgccagacaccagaacaggccgggggccgcctgctccaggcactaggtggggaaggc
agctcccgcaccccctgacctcagtgtcttgtcctgcaggtgagcctggactcccgtgtg
cgggagggcatcaacaagaagatgcaggagccgtccgcacacacgttcgacgacgcgcag
EXON 6  795 bp
gccgaggccaaccagcatgtggtagacgagaaggcgaggctcatctacgaggactacgta
tccatcctgtcccccaaggaggtgcgccagacaccagaacaggccgggggccgcctgctc
caggcactaggtggggaaggcagctcccgcaccccctgacctcagtgtcttgtcctgcag
GTGAGCCTGGACTCCCGTGTGCGGGAGGGCATCAACAAGAAGATGCAGGAGCCGTCCGCA
CACACGTTCGACGACGCGCAGCTGCAGATCTACACGCTCATGCACCGGGACTCCTACCCC
CGCTTCCTCAGCTCTCCCACCTACCGTGCCCTGCTGCTGCAGGGGCCATCACAGTCCTCC
TCCGAGGCCTAGGCCGCCCCCAGCAGCACAGACCCCGCCGCCTCCTACGGCCGACTCTGG
GTTCCCTTCAGGTGTTGTTGTCGGCAGGGCTGTCAGGGCACATGCCTGGCCGGCTGGGGT
CCCCACCCGCGGAGACGGTCCTAGACCCAGTGGGGAGTGCTGTGTCTCCTGGGTCTGCCC
ACCCGTGGCCAAGCAGGAACTCCAGGTGCAGGGCGGGCCTCCAGGTGCAGGGCGGGCCAG
AAGCCCCCTCATCGGCCCGCAGCTGGCTGGCCCAGTGCTCCTGGCTGGGGGCTCTTGCGT
GGTGAGAGTAGGGGTCCCCCCAGGAGCCATGCTGGACCCATGAGCCTCGCTGGGGCCTCC
TCCCCAGGCAGCCAATGGGCCCCAGACAAGCCTTTGGTGGGGAACAGAACCTCCGCATCG
TGTAGTTTTGTGACATAAGGAGACCTCCTACTTGAGCTGTCTGTACCCCAGAATCAAACA
CAGAACCTCAGAACCAGATTTAGGACCTCAGAATCCTGCACTCAAGGTGGCAGGACCCAA
TTTCTGTTTTATATGTTCATGAACTTTAAACCTGGAAACATGTCCTTACTAGGTGTTTTA
TCAAAAAAAAGTTTT
catatttatctctatccctaaccccccaaaaataggatgtcttattattgaagatatttt
taaagcaaagtctctactcatttttgtccaagtctggggagagactggagaatgagtggc
cccagactcagggctggggagaagtgtccttgtcccagggcaggggctccagtgcccctt
EXON 7  25 bp
aacacagaacctcagaaccagatttaggacctcagaatcctgcactcaaggtggcaggac
ccaatttctgttttatatgttcatgaactttaaacctggaaacatgtccttactaggtgt
tttatcaaaaaaaagttttcatatttatctctatccctaaccccccaaaaataggatgtc
TTATTATTGAAGATATTTTTAAAGC
aaagtctctactcatttttgtccaagtctggggagagactggagaatgagtggccccaga
ctcagggctggggagaagtgtccttgtcccagggcaggggctccagtgccccttggaggg
gacacacagccgtgtgcttgccctcttcccatgccctggcctccaccagacccctcctca