Gene PSMF1 Variant 3
DNA : 48.73 KbNT_011387
mRNA : 3152 bp NM_178579
CDS : 600 bp NP_848694
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  301 bp
ggcctcttggaggacgctgtgcccgcgtcaggcgatcctgtcgactgccgccaagacccg
gcttccggctttgaggggccacgccccgctcgcactccctggcggaacctttcagtgctg
cgctcgcgttgccaacccggcgcgcctcacgcagttgcgcccgctgttgggactacttcc
GGCTTCCCCGCCCCGCCCCGTCCCCGGGCGTCTCCATTTTGGTCTCAGGTGTGGACTCGG
CAAGAACCAGCGCAAGAGGGAAGCAGAGTTATAGCTACCCCGGCCGCGGAGCCGGCTCAC
TGCACTACCCCCGCCCCCTTCTTTCCTCCAGACGCCGAAGTCGCGGGCGCTCATGGCGGG
CCTGGAGGTACTGTTCGCATCGGCAGCGCCGGCCATCACCTGCAGGCAGGACGCGCTCGT
CTGCTTCTTGCATTGGGAAGTGGTGACACACGGTTACTTCGGCTTGGGTGTCGGTGACCA
G
gtacgccacggagccggccagggtggaggagggaactgtcttctgcccaaactcagagta
ccggaggcctggtccagagcgcccgatttccccgcttctcccagtgcagggtctggggca
gatggcagcgttggtaaaacctgcgggtcggaggttgctcacctgccccatcccagccca
EXON 2  153 bp
cccagagacctgggccctagacctctctctcgctgtaggatcttgggcaagtcatttctc
ttgacctccacatcttcatctgtgaagtgaggtgggtaagattagcttatctcgtgaggt
tctttatagttctgtgttttgagttcatgatctttctcctctcaactgtggtcttcccag
CCGGGTCCCAATGATAAGAAGTCAGAACTGCTGCCAGCTGGGTGGAACAACAATAAAGAC
CTGTATGTCCTCCGGTATGAGTATAAGGATGGGTCCAGAAAGCTCCTTGTGAAAGCCATC
ACCGTGGAGAGCAGCATGATCCTCAATGTGCTG
gtgagtctctgggacacgtgagtctgctgatgagatggggataggaatggctgttttgaa
acccatttaacggtacgaatccagagcttcaatgttcatgtagcccttacctagtgatcc
cacttctggaactttatcttaaggtgagaaccctaagtatagaaaaccttcgtgcacaaa
EXON 3  186 bp
tggggctgttgcccccctcacccaggtccagcaggcggcctgttcccccacttataaaca
ggccaagcgcaatgccaggagctatcagggccgccgccgccgccgtcgttgcagccagaa
taccacttccagggttcctagccaactgcaagcagttgactcttcatctgcttcctgcag
GACCTACAAGAACAGTGAGGAGCTTCGGTCTCGTATTGTGTCTGGAATCATCACACCTAT
CCATGAGCAGTGGGAAAAGGCTAATGTAAGCAGTCCCCACCGGGAGTTCCCCCCTGCTAC
CGCCAGAGAGGTGGACCCACTCCGGATTCCTCCACACCACCCACACACCAGTCGGCAGCC
TCCCTG
gtgagtacagagtgcctagcgggaagcccatgcttctgtagagggattccagccagctat
ccccatcctgccacttgaccccatccctggcccgtatgtgttttcaacaaaatgatcagt
gtcttggggtgcatggagttagaaagtggagacgtaagtggagcagtgagttcttgaact
EXON 4  54 bp
tacataattgtcattgtaggattatcattgttcatctgagccaaggaccaccctgaaata
tcccttgtgctatggtctcatgcaagggtttcccatgcctgtgagtgtgtttgtgatccc
acatgtatcaggtgcctggctgctctgggacttgcagtaattgtctcttgtttgtttcag
GTGTGATCCCCTGGGCCCGTTTGTTGTCGGGGGAGAAGACTTAGACCCTTTTGG
gtgagtactgctggggaggtggcagcaacacaacttgcttttgtggcttttcagccccag
ctcatcttctaattttagagttttcggtcagtctcttcctttggggtggaggaggcagtt
gttgctgagcagctgagaaagcactgccacatacgctgcccctccacacctagagcggtg
EXON 5  159 bp
aggctttgtgttcttgcccttgcccactttccgctggctctcaggcagccatccacatgt
ctgcttgggccatccagagtagacatcccagccattcttggtgcattgtaacctccctcg
ccttttctccaagggcagtccttgccacacctgcttacctaacttttcttcttgcctcag
GCCTCGGAGAGGTGGCATGATTGTGGATCCCCTGAGATCTGGCTTCCCAAGAGCACTTAT
TGACCCTTCCTCAGGCCTCCCGAACCGACTTCCTCCAGGCGCTGTGCCCCCAGGAGCTCG
CTTTGACCCCTTTGGACCCATTGGGACCAGCCCACCCGG
gtacgtagtcactcaggtatgctgagaagtaggacctgatggcagcttggttcagtgtgg
cagcaatgaaggtttctagccccaggcacagagctgccgctgccttcacctgttgctgcc
aggagagtggagcctcctccagggccctgcctgatttctccctggagccttctaggagct
EXON 6  2299 bp
taccaagcgggggagtcaggattcaaaccccggttgtctggctcttgagtgcatgtgttt
aaattcctcacaccgccacatcatgttgaagggcaggctccctcagtgcagggtcatgtc
tgcccatgttcccctggtctctccatcactccaactcatcagcccctctttccattccag
ACCTAACCCAGACCATCTCCCCCCGCCGGGCTACGATGACATGTACCTGTGAAGGCCTCA
AGAATGTAACATCCCAGGCTTCCCTCCATTCTCCTGGAGCTGCCACCGCTGTCCCCATCA
GCAACCATGTTCTTGCAGGCTGGGGGCAAGGGATTCTGCTCATGTGTTTGCAGACCGGCT
GGGATAGCCTCCCCACCCCTTATCAGAGCCAAGACACCTGCTGCAGCTCTCCACCTAGCT
GCAGATAGCTCCCAAAGAGAAATCAGTGTGTCTCTTTCACCATCAGCTCCTCCCCTTTCA
CCACCAGCTCCTCTCCACTTCCCAAGGGAGACTCCGGCAACCTTCAGCAACATATATCCT
CGACCAGATGCAGTGCTATAAGAACAGAACGCATTTTGGATGTTATTATTAAGAACCAAA
TGTCAATACAGAATTCATGTTGCCGGTTTCCCACTTTTCTTTTTACATTAATGCATAGCT
GCTTCCATTTATGAGACTTTAGAGTTTGAGTTTCTGTAGGGCTGAATGACTCTTTTTCCT
GCCCAGGGCCCATTCTTGCTTCTCAGGCACCTTCCGTTTATTAATTGCCATTGCTCCTGA
CATCACTAAGATGGGTCCCCTTCTGGCTGCATGAATGGAAATGAGTGACTGGAAATCCCA
TAGGCCACAAGAATGACTTTCACAAGGGCAGGAACATTGTGGAAAGACTGCATCATTCTG
ATGAGGCAAAATCCTCCAGCTATTCCTGTCTGGGCCAGTTTTGTAGGTCCATCTGTGCAT
GGGCAGCAGTAGTCAAAAAGCCAAGGAAAAAACAGAGCAGACCTGAAGGCTAATCTTATT
TTTGCCACTAACTTAGTGAATGACCCTAAGCAAGTTCCTTCTCCTCTTAGGGCCTTGTGC
CAAGCCTATGAAATTGGAGGTGGCTTTCCTGCTCTAAAGCATTTTGATGTCTCATTCTGT
GTTTGGTAACCCCTATAAACTGGGGCAGAGGAAAAGAATGATGGTTCAAGGCCATACTTC
CCTTGAACCTTGTGTGGTTCTTGCCTAACTCTGTGGTTTTTGGACCCCATGGGGCCCAGA
CAGAGCACAGGAGCATGGGCTGCCTCTGAGTGTGGTGTTGAACTTCGGGAGGAGCAGGGA
GCCCTGCACCTTGTGTCCTGGCCCACCTGACCTTTGGTGTTCTCCGGATCCTTTTCAGCC
CGAGGCCTGACAGACGCGGGCAGTGATGAGCCCTGTTCTGGAGTGGAAAGAGCACGATAG
AGCACCAGGCTAAGAGGCACGAGATCAAGGCGGTAGTCACTTCCGCTCTGCAGCTAGCAT
TTCAACCATATGTGGATCCTTTCATTTCTCAGCTCCCTGGATTCCTTCCCCTAAATTAGG
ACCTATTATTTACCTGTAGGTAAGCAAGCTACTGTAGCTCTTCTGAGGTATCTGCCAGGC
TGTTTTCTGTAGCCTCAGATTGCCTATCTGCTTAGCCTGAGAACAGGTAGATGAAAACTA
AACTGATGCCTAGGCCCAGGGTCAGTCTCAGATGGAAGCTGGGCCTGGGTGGGGAGGCTA
GCATGCGTGGCTCCCTGGGTATTTCTGTCAGTCCCCATGGCAAGCAGTGATTTAGTAAAA
CACCCCAGAGTCAGGGAAGCCAACCACCTTGAAACCTTTAGAACATCTCTGCTTTGGAGA
AAGACCCAGAGATCAGGCAGAGGTGCAGATTCAATCATTACTCATAACCTTTGAGAGATG
GCAAATGGGAGGAGTGTTAGTCTTTGTTTTGGAATTGGACCATTCTTGCAACCAAAAGGA
CTTAGAGCAGTTTGCTCATAAAGACATCCTTTATTATAAAAGGAAGTATTTAAAGGATGA
TAGAGACCATCAGATAGAAGCAGGGAAGGTAGATAACTTTTAGGACCTTGATGTGAGGAA
AAGATAAAATTTAAACAATAAATTTGCCACTTAGATTTTCTAGCAGCAAAGTCCGAAAAG
ATAGTTATATACAAAATTCTGTTTTCTGAAAACAAAATTGTGATTCACCTTCAGAATTGG
CCATTTTTTTTGTGAGTTTCCTTGCATCAAGGACACTGAGAAACACAGTCATTGTCTTAG
GTGTTCTATGGGAGGAAGTGAATAGAGCCTTTAGGAACTTCCTGGTCAAGCTTATGGTGC
TTATTTTGATCTGGGCCACTTCCCTCCTTCCAGTCATGAGTAATCATCAAGGAGCAAGTT
GGAGTGTTTCAGGTGTATATTTTGTAGAACCCAAAAGATTGGAGCCTTAACAATAAACAT
CAGCACTAAGTGACCTGTT
cctccttttttaaatagcagctttattgagatataatttacatacccataatttacatac
ctgtttaaagtatacaattcagtggatttagtatgttcacagtgttgcacatccaccacc
atttctaattcctgaacattttcaccacctcaaaaagaaaccacacacccattggcatga