Gene MYH7B Variant 1
DNA : 4.09 KbNT_028392
mRNA : 1566 bp NM_033424
CDS : 531 bp NP_219492
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  165 bp
gggtggccgcgagtcttctgaatctggagtggaggaagccctggtgtttgagggtgtgca
tgtatgctgggcactcacccaaggaggctgcattgggagccagagggagtcgcctagtat
ctggtcttgtgggttgggggatcgtgccctagttcagctcccttgtcactgccatcttcc
AGTGCCTGCTGCCTTGGGCCGCCTTGAACCTCCAGGGTTTCCAGCTCCTCCTCCTTCACC
CCAGTGCCACTGCCATGATGGATGTGAGTGAACTTGGGGAGTCTGCCCGCTACCTCCGCC
AGGGCTACCAGGAGATGACGAAGGTGCACACTATCCCATGGGACG
gtaagtggagacagagggggaggggtcatagccacagagatgcccttatggactcagacc
aggaattgggaggggtggcaccagctcagggctgaaggggcattggggcctgacagctgg
agccctggacctttcctgcagagtctggggcctggaaattaaaaccccagggacactgta
EXON 2  107 bp
ctcccagctccgcccttcctgagcctgggtttggagggttcttcactggaactcctgggt
cctggcagaggggctttggggagggtcacagctgtatggataccatggcttgggaactcc
agctagaacctggaggtgcctcagcccctctctgagtccagagctctctctgcaacccag
GGAAGAAGCGAGTCTGGGTGCCTGATGAACAGGACGCCTACGTGGAGGCCGAGGTCAAGT
CGGAGGCTACCGGGGGCAGAGTCACCGTGGAGACCAAAGACCAGAAG
gttccgttccccctttcctgagattagcctctctgtccctaggcctcctggccaacagga
tctgccctctggttgaagggggtctgggtatgtgggtgggggtgacaggtgaggtcggtc
ggttcctcccggtcccccggcccctgacacgatctccctggtaggtgctgatggtgcgtg
EXON 3  144 bp
gaccaaagaccagaaggttccgttccccctttcctgagattagcctctctgtccctaggc
ctcctggccaacaggatctgccctctggttgaagggggtctgggtatgtgggtgggggtg
acaggtgaggtcggtcggttcctcccggtcccccggcccctgacacgatctccctggtag
GTGCTGATGGTGCGTGAAGCCGAGCTGCAGCCCATGAACCCGCCTCGCTTCGACTTACTG
GAGGACATGGCCATGATGACGCACCTGAACGAGGCCTCTGTGCTGCACAACCTGCGCCAG
CGCTATGCCCGCTGGATGATCTAT
gtgagccccaggcccgggccatgggcggggtggggcttgtatgtggggcggggctagaga
tgaggtgctgggggcgggcccatagcggtggggcggggctgtgagcggtggatcggggct
gtgaatgatagagcgggtccatagcgggggtggggctgtgagcgatgaggcggggctctg
EXON 4  157 bp
aattagccggtcgtggtggcacgcgcttgtagtcctagctaccctgggaggctgaggcag
gacccaggaggcggaggttgcggtgagccgagatcatgccgttgtactccagcctgggag
acagagcaagactccatctcaaaaacaacaacataaaccctacctatactctctcttcag
ACCTACTCAGGCCTCTTCTGTGTCACCATCAACCCCTACAAATGGCTCCCAGTCTATACG
GCCTCCGTAGTGGCTGCTTACAAGGGAAAGCGCCGCTCAGATTCCCCGCCCCATATATAT
GCGGTGGCGGACAACGCCTACAACGACATGCTGCGCA
gtaagggccgcctggactcctccccaaccgcagaccccgacctcggtcccgggaggcctc
tgtaagggacccccttcccccactggcactgccccccttttgacgctgctggacatggtc
gcccagccgttctgtccctccgcatgggagctgacctccactagggacagccccacctgc
EXON 5  993 bp
tcgcccagccgttctgtccctccgcatgggagctgacctccactagggacagccccacct
gctccttcccattcctggctctgggtggtggggtctgccccagatggatacccagggtgt
tccacctgtggctggccccacaccttggctgacttctctatccccttccctttcctccag
ACCGAGACAACCAGTCCATGCTGATCACGTGAGTGTGGGGCTCTGGGGGTGGGGTGGAAA
ATGCTGGCCATCTGGCAGAAAGAGGGCGGTACCACAGTCATTTCCCAGGATTGAATCCAA
AGTGCTTAGGCCAGGACTTTTACCACCTGGAGCTAGTGTCCCAGCTGAAGCTAAATTAGG
CCTGAGCACTTTCCCTGCCCCCATTCTGAACAGATGTGTTCTTGATGGGGGATAGGGAGG
GGACACCCACAAACGGAGTGACCACCAGCCCCACACCTCCTCTCCCCGGGGCCTGGAATC
TCCCACCTTGATCCTCTGGGGTTCTAATTCTGGCTCAGGGGCAGCGGAAAGATTCCTCTG
CTTTTCCTCCTTTTTACCATCTACTTATGTCTGAATCTTACCTCTGATCTTTCCATTGCC
TCTGTGGGAAAATGGTAGAATAATTCTTACATGCCAGGCTCATGTCCAGTCAGGCCAATA
TGGACAATGTTTAGTGTGAGTGTGCATGCGCGTATGCAGTTAAGAGCAAGTGCCTTGGCC
GGGCACAGTGGCTCATGCCCGTAATTTCTGCACTTTGGGAGGCTGAGGTGGGTGGATCAC
TTGACGTCAGGAGTTCGAGACCAGCCTGGCCAACATGGTGAAACCCCATCTCTACTAAAA
ATACAAAAAATTAGCTGGGCGTGGTGGCAGGTGCCTGTAATCCCAGCTACTCAGGAGGCT
GAGGCAGGAGAATTGCTTGAACCCAGGAGGCGGAGGTTGCCGTGAGCCAAGATCACGCCA
CTGCACTCCAGCCTGGGCCACAGAATGAGACTCCATCTCACGAAAAAAAAAAAAAAAAAA
AAAAAAGCAAGTACCTTTAACCCAGACGGGCCCGGCTGAGTGTGGTGGCTCACACCTGTA
ATCCCAGCACTTGGGGAGGCTGAGGCAGGAGGATTGCCTGAGGCCAGGGGTTTGAGACCA
GCCTGAGCAACATAGCGAGACCCCATCTTTACC
aaaaaaaaaaaattgaaaagttaaataaaaaatcctacctaccacacaaagttatgagtc
agtgagttgatatatgtgcctggcacacagcagggacagccacagaactcctgaggccca
gttccttgttcctaaaatgggggtgataatggagcctgccttccagggttttctgagctg