Gene GHRH Variant 1
DNA : 5.80 KbNT_011362
mRNA : 454 bp NM_021081
CDS : 327 bp NP_066567
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  83 bp
aggtctgtctgacttccagtgtctgggttctttttcccatcccacagcttccaaaaacca
aggaccaaggcttgccatggagccaagcccagggctgggccagtgaaggccatcccaatg
gctgtggctgtacctgaccttcccctcctgtcactctgcaggtgccaccccgggtgaagg
ATGCCACTCTGGGTGTTCTTCTTTGTGATCCTCACCCTCAGCAACAGCTCCCACTGCTCC
CCACCTCCCCCTTTGACCCTCAG
gtaagcagaccctggggaaagttcccaccactcccaagccatccctgccatggggcaggc
gttagtgaatgcagactcagcccatcagctgggccctggctatgtctccaggcagcaccc
actgcccgtccttgcagaggaggcagacacagcttcacagaggtcactcagaggggtctg
EXON 2  105 bp
tccttgcagaggaggcagacacagcttcacagaggtcactcagaggggtctgagtctctc
ttggggtgagtgggacagatggcaacagaaggatcttgcagagacatggcgagtgcagcc
acgactgtcctctcgcctggcctccaccccgccctctgacccctgactccttccgcacag
GATGCGGCGGTATGCAGATGCCATCTTCACCAACAGCTACCGGAAGGTGCTGGGCCAGCT
GTCCGCCCGCAAGCTGCTCCAGGACATCATGAGCAGGCAGCAGGG
gtaagcaggagttctagtgatttcttcccacaccctgcagcagagtctgcaggagcttgt
tccctacaggggaccagggaccaattcagatctcttccttggcacagcaagtgtcatttc
tggacttcccatagcaaaagggttccagcgttaaacctcaacttacctccatgcctacca
EXON 3  120 bp
gtgtacacttgtacttctgtgctcttcattactatatatactgcctccctaagtgtggct
gaatctaattcagttgggtagaagagtccacaccagatattgaaataggcatagggatat
acccctgcctttccacatcctacccaaatagcaactagttctctttttctaaccacacag
AGAGAGCAACCAAGAGCGAGGAGCAAGGGCACGGCTTGGTCGTCAGGTAGACAGCATGTG
GGCAGAACAAAAGCAAATGGAATTGGAGAGCATCCTGGTGGCCCTGCTGCAGAAGCACAG

gtatgggtgtgtgtgcatgggtgcatctagggacttcagggcttcctaccccgtggtttg
ccaggaaaaggaaaaaatccactcctctctgaaggtatggggctctgccaaacaaaccaa
gaacaaggaccctcctgacagacattaagaactaggagagtggctgggtatggtggctca
EXON 4  146 bp
agcctgggactcgccttgctggcatgcttgcgcatccttccctccaccccacactgcctc
ttttggaatccaaaaggccagctcctgtcacgggagcacccgtcaccctggttccatgca
tcccactctagccacccttacttcaattccccggattgagcttgatctttctttctgcag
CAGGAACTCCCAGGGATGAAGATTCCTCCTGTGACCCGGGCTACCTGTAGCCAAAATGCA
ACTGGATCCAGTTAATCCTCTCATTTCTGACCCACTTTTTCCTTTGAAAATACAATAAAA
TTCCCCCATACCGGTGTGCATTTAAA
tgttcttttctcttcagcctaattttttatgtgttttacatagttacatttcccaaagtg
gtattacgaggtgtaattttttttaaagctaacatttaccaagcacgcagagtgcaaacc
aggcagcttcatgcataggatctcatatgctccttacacaggctgatggagggtactggt