Gene CST3 Variant 1
DNA : 4.28 KbNT_011387
mRNA : 775 bp NM_000099
CDS : 441 bp NP_000090
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  318 bp
ggcggggagaggcaggggaggcggggagaggcaggggaggcggggagggagaagggaggt
gggagggacgaggcgttccggaaaagggagtgcaggccgcggtggggtggggcggcgaag
gccggaagggataaaaccgcagtcgccggcctcgcggggctcacggcctcgcctcggtat
CGCAGCGGGTCCTCTCTATCTAGCTCCAGCCTCTCGCCTGCGCCCCACTCCCCGCGTCCC
GCGTCCTAGCCGACCATGGCCGGGCCCCTGCGCGCCCCGCTGCTCCTGCTGGCCATCCTG
GCCGTGGCCCTGGCCGTGAGCCCCGCGGCCGGCTCCAGTCCCGGCAAGCCGCCGCGCCTA
GTGGGAGGCCCCATGGACGCCAGCGTGGAGGAGGAGGGTGTGCGGCGTGCACTGGACTTT
GCCGTCGGCGAGTACAACAAAGCCAGCAACGACATGTACCACAGCCGCGCGCTGCAGGTG
GTGCGCGCCCGCAAGCAG
gtgcgtgccgccccccgcagggtccgaagccccggccccgccgtcccagcctccccccgc
gctgctcccggaccccgtgctgctcctctccggcgcctgggcttctcacccggaccctgt
tcccggtcttcgctgtcacccccgagcccttggcgggcgtgtccgggaatgccctgagtc
EXON 2  114 bp
tccctgccagctggcaggaggaggtggcttgtgtgccttgcaggtgacaatgtgggcagc
tcatgaaggtaggcttgaagccccaggcaagcccagtgacccggtcacagtgaagtgcct
gtgtgtgtaagaaactgacagaacgtgctgtccctgcctcctgctctttcacatgtgtag
ATCGTAGCTGGGGTGAACTACTTCTTGGACGTGGAGCTGGGCCGAACCACGTGTACCAAG
ACCCAGCCCAACTTGGACAACTGCCCCTTCCATGACCAGCCACATCTGAAAAGG
gtatgtgccttatatgggtccagggccagtcatacactgcagaggggtgtgtgtgtgtgt
gtgtgtgtgtgatgcacatgttctgcagggtacgtgtgcatgtgcctgagtgtgtgtaca
cgtggagatgcatatgtgtttccaagtataggtttgtgtggggaagtgcacgtgagtgtg
EXON 3  343 bp
ggagcagtcactgcccagtccagcggtgctctgggatcagcgggggtgggtggaggggta
gataagggcccagtgtttcacctccatccttcttcactcccactctgatgtcccgtgcct
gggcatcttctgctttgaactgtaacccacactgattgtcccctctgtttcctttcacag
AAAGCATTCTGCTCTTTCCAGATCTACGCTGTGCCTTGGCAGGGCACAATGACCTTGTCG
AAATCCACCTGTCAGGACGCCTAGGGGTCTGTACCGGGCTGGCCTGTGCCTATCACCTCT
TATGCACACCTCCCACCCCCTGTATTCCCACCCCTGGACTGGTGGCCCCTGCCTTGGGGA
AGGTCTCCCCATGTGCCTGCACCAGGAGACAGACAGAGAAGGCAGCAGGCGGCCTTTGTT
GCTCAGCAAGGGGCTCTGCCCTCCCTCCTTCCTTCTTGCTTCTCATAGCCCCGGTGTGCG
GTGCATACACCCCCACCTCCTGCAATAAAATAGTAGCATCGGC
tccctctgagttcttggctgtctggggatgtgcacacaggcagggtttccgcagttcctt
tatgaagcctccttgtcctgctggtgtgaagatgagaggagtacctgggagctgacgcgg
ccacagcaaggccatcaggcaagctgctgctataggagtcctgagtctcagagcagggag