Gene CDH26 Variant 2
DNA : 16.74 KbNT_011362
mRNA : 1078 bp NM_021810
CDS : 498 bp NP_068582
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  215 bp
aggctcctagatgtagatcagaggttgccatgctggccaggcaagatccctggccagcaa
aagcagcttctactcacaatggaatccactggtaaatatagtcaaggagtggccctttgt
ttgtaataaccatggagacagcaatgtacagatattcaggctcctggacttggcaaggct
AATAAGAAAGCAGCTTTTCCAAGAAACAATACAATATTACTGGCCAGATAGTATTATTGA
TTAATTCAACAAACAGTTATGTAGCATCTACTGGTACCCTGGAACTGTGCTGAACTTTAT
AGCTACACAGATGACTAAGACGCAATTTGGCCTTGCCAGTTCATGACTGAGTTATACATG
AACAGAACAAGATCCTCATGAAACCTCTGATATGG
gtgagcttgtctaatctgtttttcccctttgtcttataacagtggctctgctttttctgt
tgcgatgctattttgtgcttgaacctaagaggcatggatgctctgtatccaatgatgaag
gccaccaaacactggtcatgtataatgcggagagcaaaggcacttcagcccaggtagtgg
EXON 2  78 bp
tcttttcccacataagtcatccagatttacaggagaggtgtattttttacagtctggact
tcttctgtgatggcatagatacaatgtgttttggagaaaatgtcattcctttccttctgt
ttttatttctgctatctgtgatttcagcccttgtcatatttctttctctgtgttctacag
ACATGGTCAGATGTTGAAGGCCAGAGGCCGGCTCTGCTCATCTGCACAGCTGCAGCAGGA
CCCACGCAGGGAGTTAAG
gtaacatgccccttacttgcttctggatttcagagaagtgactttcctggtggtttccct
gacaaggaacacctgggatgctcctcccagtgccacatccagggaggttcttcttcaagt
cagcaaccccagcccctacttgcaaagccccatggttcccttagcctaaaacacccttgt
EXON 3  69 bp
ttccctgcctctcttcattttccttttcctcccaccgcgccctccctctcatcgtgttaa
tttgtgtttgcctatgaatatatgagcaaggggaagtggtgagaggtcacgcatgcccac
tttgtttccagctggagagaaatccattctcttttgagtaaatcagcattttccctctag
GATCTCGAGGAAGTGCCTCCATCTGCAGCGAGTCAGTCAGCCCAAGCACGCTGTGCTCTG
GGGAGCTGG
gtgagttccagaaggttgctccctgctacggccatctcactagtgactaacagttggtcc
ccctgagagagggccgttgtagaagattcggtgatactgtcagaaaaaggcacatagtca
atgaaaatctgagaagctgggctttttccacccgactctatttccatctatagaactagg
EXON 4  54 bp
cttcacaaagcaactgtgaaacttgttcatgaatttctgctatgaatatctacactcttt
agaattactatacctttagtacaaaaatgaaaggcaatatgactgcaagaatttctagtt
atgtatttgcatcctttggtaatttatttgaaatcagtaaatatttcatctttctttaag
GGTTATGGCAAGCCCTTTGAGCCAAGAAGTGTGAAAAACATACACTCTACTCCT
gtaagtatagatgtaggtgttaccgtgaacaaatttaccttattgttctgcctaaaagct
gtgcaaatccctgaaaattggaaatttggaaggaaagaggtgataaaaaaaaatatgccc
aacatccaagcaaactgaaggagaagcgaacgtgaagagaggttggaagtagttaaggca
EXON 5  75 bp
tccctctctcccccaacacaaagagaggaaacgtgagcaaactaccctgggcctggctct
tcacctccaagagaacggtgctcagtgtgccccatctatgctggggccactgacacacag
gggttggggggtaggacaagggctctgctgtggtatgaagctctactggtttgcttgcag
GCTTACCCAGATGCCACAATGCACAGACAACTCCTGGCTCCGGTGGAAGGAAGGATGGCA
GAGACATTGAATCAG
gtagggagagctccccttgtgctgtgcactagctatgggttttgcatccccactgtgctc
caggcttgatttggggacacttcctcctaaatcactgcattagtcagctaaggctgccat
aataaaataccatagcctgactggtggcttaaataacagaaatatattgcctcatgtttc
EXON 6  587 bp
atgtctcccctcagcatggctgccacttctggaactgtacgaactcctgtgtcagctgag
gacacggggcctgagtgctgttactactgcattgatgtgttcctcgaatcaaacctagag
aaatgagctgggtatggaagcacatggcatttaccttctctttcccccacttttccccag
AAACTCCATGTTGCCAATGTGCTGGAAGATGACCCCGGCTACCTACCTCACGTCTACAGC
GAGGAAGGGGAGTGTGGAGGGGCCCCATCCCTCAGCTCTCTGGCCAGCTTGGAACAGGAG
TTGCAACCTGATTTGCTGGACTCTTTGGGTTCAAAAGCGACTCCGTTTGAGGAAATATAT
TCAGAGTCAGGTGTTCCTTCCTAAAAAAAAAAGTCTATTTTGGAGAATTGAAATAATTCA
TGGAAGGGAATCACTATTCAGGGATTTTTCCCCTTTGCTCTTCTTTTCCCTCCTTAAAAG
AAAAATTACCTTCTAGTCCTAGGATGAGGACACACTATTAGTTTGAATTAAATGCTTTGA
TATTCTCAGATCAGCCATCTTGAACCAAAGCAAAACCACAAGTTACACTTTCTTAAAATT
TGATTTGTCATATTTTCTAGAGAAACTTGAATTTAATTGTGTTATTCTTAGCTTCCACTG
GCAGCCTAGCTTTGAGGGTAAATGAAAATATAACCCATAGATTACCCAGCCACTTGGGAA
CAGCAGGTAATACTGAAGAAAAATAAAAATAGATTTTGAAAACGTTA
cttacatttctatgattatgattctgcttccatttaagggaaaacttaggtaaatagaga
aattttttctataacatttgtagtcagtatttgaagtgattttttaaaaaataagtattg
gtccctgttcactttttgattagataaatagataaaatatgttatcttgagaaaaatgat