Gene CDH26 Variant 1
DNA : 54.69 KbNT_011362
mRNA : 3181 bp NM_177980
CDS : 2499 bp NP_817089
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  369 bp
agaggataagattatagaaaatagtcactaacatatcctgctatagaaagagatgattgg
accttctatttggaaaccagaacaaacaaggaaacaaagaaacaaataattctgctttcc
gataggtgctggttttacttccgctggctgagctgttgttcctgaggtcagaccccagcc
AGTCTTTTGTGTACGTGCAGGACCATGGTGGCTTTAGTTTCTACCCCACCCTTCCTAGGA
ACTCTACTTGTGGCAAACGTATGTTCAAGCTTACAAGTCAGCCCACCCCACTCTGATAAA
TGCAAGAAAAGCTGAAAAGGGAGGAGCAAGATGGGATGAAAGCATCTGGGCCAAAGTGAC
CTGAAAACCTTTAGAGAAGAAGCTGCTGGCTGAGAAGGAGGTGTGTGGCTCCGGTGAGAC
CACCAGCTTGGAGGACTGGTCATCAGCTGCACGTTCTGGGTCTGTCTTGGGTATTCCCAT
ATGGCCATGAGATCCGGGAGGCACCCCTCGCTGCTGCTGCTTCTAGTGCTGCTGCTGTGG
CTGCTGCAG
gtaagctgagcctgcagcctagtgctcaggtgcagggaactgaaagcaaagcacaagctg
gccctgccccttctaggctaagggaggggagagggactgagtgtgacctgctgggaccca
gggctggctgtcttgagaatggcttaggtagcaggggctctggatttatataaagggaag
EXON 2  57 bp
gagaagataagtggcaatcatgaattaagatgtagaggataagaaattctatttaccaaa
actaactacagaagttctgttttcatcatttctaattctagatttgtgcaactccaggtg
gtttccatgtgattctggtaagaatattctctactaattaatattatttttatttttaag
GTCAGTATCATTGACAGTGTTCAACAGGAAACAGATGATCTTACTAAGCAAACAAAG
gtgaggtttggaagtcagtttcttaatatataaaatcagtctctacacttgacttagaga
cagaattgcagtttggagttctttagtgccctgccaatgtttggtttgcagaaaataaaa
tagtaacttcatgtggccttttagaatcttgagggactgccagagagttgcaggtgatgc
EXON 3  105 bp
ctctacagctattaagaagacaggcacttgggttttccaagcttaggtggctgttctggc
gatgagagaatgcaggccaggtgtcagcacagggcctttacatgaagtaagggtgtgata
aatcctggctgtgagcatcactgccatcctcattgtcaccagtgtcactataagttccag
GAAAAGATCTACCAGCCTCTACGGCGATCCAAGAGAAGATGGGTTATCACCACCTTGGAG
CTGGAGGAGGAAGACCCGGGACCCTTTCCCAAACTCATTGGTGAG
gtaaggtgcctactcttaaggaatgaccccatcatgccctctaagtaagcacgccccttt
ggccaggaagattaagtcttgaaaggttatgtgctagtgaggccagggagtgaagtagag
cagaaggagcactggcctggggttcaggaagcctgggttctagaactcactctaactcta
EXON 4  162 bp
gctaacagttcaacatcattgttcctgcatctcagcccatctgtttatttctttggcaga
tgtgccattgctgggtataatttcttaaagatgccattgattcttagccttgatacttga
ttatcatagtggcttattctcatcctccttttttcttctttccatttttcctccttccag
CTGTTCAATAATATGTCTTATAACATGTCACTAATGTATCTAATCAGTGGACCTGGTGTG
GATGAATATCCAGAGATTGGTTTGTTTTCTCTAGAAGATCATGAGAACGGAAGGATATAT
GTTCACCGCCCTGTCGATCGAGAAATGACACCATCTTTCACG
gtatctaaaacttgatatattctaagctcggatttaaaagctcttgcaagactgttgtat
ttggtaagcattatttaagctgactatgtgccaggttccgggagattgagaaattatgcc
ttgtgacaagctttacgagtatgcctgagacttttgtaatcttcttttagagttgtggac
EXON 5  148 bp
ccagtactgttcttgctctctggggtacttggtaaatgagggcagtctgattcctgccct
ccggaactctcagtctagaggaggagacagacgtaacacataattaggataacagttatt
ttattagagtgtcatcgagtaaatggttctgcaggatttttacagctctctgcttcctag
GTTTATTTTGATGTTGTGGAGCGCTCAACAGGAAAAATTGTGGATACATCCTTGATTTTC
AACATTAGGATCAGTGATGTGAATGATCATGCACCCCAGTTTCCAGAGAAGGAATTTAAC
ATCACTGTGCAAGAAAACCAATCTGCAG
gtgtgtgcggctggggggctgccgggcttccttctgtctctgctctgttccttttcatta
atattgatgaggagcttgatcctagtcatcttcagggagagtttttactgttcacatctc
aaagatcgcaggccttggatctgagcgaaatgctttgaggtccgtaagcctcattttgta
EXON 6  167 bp
cttataactaattaaatattcatccttatcttttctagtatgtccatagtttattttata
tttaaacattccactcattttggtatatgccccaatgccatttagcaaataattcatcct
cttactggtttgataggctacctttatctgatagtaacaatttttaaaaattctttctag
GGCAACCTATTTTTCAGATGTTAGCAGTCGATTTGGATGAAGAAAACACTCCAAATTCTC
AAGTCCTTTACTTCCTCATTTCTCAAACACCATTACTGAAAGAAAGTGGTTTCCGGGTTG
ATCGCCTTAGTGGAGAAATACGACTCTCTGGCTGCTTAGATTATGAG
gttatgtggattttattattttttttaaatgaaatgtgtggcccatccttgagccccagg
cttagattctacatttgtagtggggaaccctctgtggctagatttgctattgaaattcct
aaacagaatatttctttattaatattttcctttcctgtatttgaggggcttaactttcct
EXON 7  129 bp
ttattttttttaaatgaaatgtgtggcccatccttgagccccaggcttagattctacatt
tgtagtggggaaccctctgtggctagatttgctattgaaattcctaaacagaatatttct
ttattaatattttcctttcctgtatttgaggggcttaactttccttttcctcccacatag
ACCGCTCCTCAGTTTACACTGCTAATCAGAGCCAGGGACTGTGGAGAACCGTCACTGTCA
TCCACGACCACCGTTCACGTGGATGTGCAAGAAGGCAACAACCACAGGCCTGCATTTACC
CAGGAGAAC
gtgaggctcctgggccgccccaacgtctaagccccaaaacaagtagcccttgggtcctag
gctcagtttttctcagagagggtgttaggctgttatcatattgctgtgaagaaatacctc
agactgggtaatttataaagaaaagaggtttaattggctcatggttctgcaggctttaca
EXON 8  186 bp
caaatcccttagggcaggtttagcagcatgaggaatatccagggtgttgtgatgaggagc
aacattctttctccttctctctcttgctctctctctgcttctctccctccttcctctctg
ctttccttttcaattgtgtttttgtttccatgacatggacatgatgattgcttctttcag
TATAAGGTTCAGATTCCTGAAGGCCGAGCCAGCCAGGGCGTGTTGCGTCTCCTGGTTCAA
GATCGAGATTCTCCATTTACATCAGCTTGGAGAGCAAAATTCAACATATTGCATGGCAAT
GAAGAGGGGCATTTTGACATTTCGACTGACCCTGAGACCAACGAAGGGATATTAAATGTT
ATCAAG
gtaacaccataccggtgacataccaaccagttagtggcagacgctgaggcctcttctgta
ggatcactcacaatgaaccagggagctaacgtccgtggatgctgggtgctgagcccatta
cgtaccacacgtcaccaggcaaggaaggcagggtctcagtgccacttctgtgtgtgggct
EXON 9  260 bp
ctccataaatgatttgaaaatgagctgtagactgtcttttgatcattatcaaagacaacg
taaataataaatgaagtgcaaaagccacaagctctgagtttgcaatgatgactcggcgct
gggcttcctctggccagaggagcagcaggtgctaatgaaatcctctctctggggttccag
CCTTTGGATTATGAGACTCGCCCAGCGCAAAGCCTCATCATTGTCGTGGAGAATGAGGAG
AGGCTCGTCTTCTGTGAGAGAGGAAAGCTTCAGCCGCCAAGGAAGGCAGCAGCCAGCGCC
ACTGTGAGTGTGCAGGTGACAGACGCCAACGACCCACCAGCCTTTCACCCCCAGAGCTTC
ATTGTCAATAAAGAGGAGGGCGCCAGGCCTGGGACCCTGTTGGGAACTTTTAATGCCATG
GATCCAGACAGCCAGATAAG
gtgagaagagagggccaagaagggcggttgtttaagtggaaatagccacataaccaagag
ggctcctgttagaaaaccagctcggccgggcgcggtggctcacgcctgtaatcccagcgc
tttgggaggccgaggcgggtggatcatgaggtcaagagatcgagaccatcctggctaaca
EXON 10  143 bp
tgtgcttccattcctttcgtgaattaaacactctcgtagtttaattgctcttagaatttc
tcaaattacttgtggtagaaatagtgtttctatgacatattttgtttttttatgcaactt
ttttatcttttaatgtaagtttttaattttaaaaattgctgtccgttttccttctacaag
ATATGAACTGGTTCATGACCCAGCAAATTGGGTCAGCGTCGACAAAAACTCCGGAGTGGT
CATCACCGTGGAGCCAATTGACCGAGAATCCCCTCATGTAAATAACAGTTTTTATGTAAT
CATCATTCACGCTGTTGATGATG
gtgagtgtttacccaaaattggaaaaataaaatgctcattcttgcttcctgcgggaaaat
aaccctggtgagcgtctttcagcacagcagagaaaaggataaaataaaccttgttatcac
tctgcatccatgctggtgattatttttggtaataattcttaaaatggtaaacaagggacc
EXON 11  240 bp
ctgaatgctcataaaagcaggaaaacagatcacgtgcatgccaggagagcttatgacgtt
gaaagggaaacagttccagtatttcaggaatattttttttctgagagacggagagtgctc
attctccagagctgtgtgtgcacgagataaacaactcctgaaacttcctccccatacaag
GCTTCCCACCGCAGACTGCTACAGGGACCCTAATGCTCTTCCTGTCTGACATCAATGACA
ACGTCCCGACTCTCCGGCCACGTTCCCGCTACATGGAGGTCTGTGAGTCTGCTGTGCATG
AGCCCCTCCACATCGAGGCAGAGGATCCGGACCTGGAGCCGTTCTCTGACCCATTTACAT
TTGAATTGGACAATACCTGGGGAAATGCGGAGGACACATGGAAGTTGGGGAGAAATTGGG

gtgagtttttgtattggttacgggcaaagagtggaaaatgccagatatccaattcaaaca
gatttaggcaaaaaaggactttattagcttaaaaaaccggagaggtctgcgttctggcag
agctggctctaggtgctcaaaggatatccctggatatccttcccacacatggtctgcctt
EXON 12  222 bp
atccgtgaacttgcagttgatgtcagaagtgagggtacccttgaggacccctccctctaa
ctctgcagttggcttactttcatacagagcttggcccgtgcagggcgttcagtaagcgtg
tgttgagcagatgagcagatgagtgagtcaatgcatgccatgttctttttccctttgcag
GTCAATCAGTTGAACTTTTAACCTTGAGAAGCCTGCCACGTGGTAATTACTTGGTGCCAC
TCTTCATTGGAGACAAACAGGGACTTTCCCAGAAGCAAACTGTCCATGTAAGGATCTGCC
CCTGTGCCAGTGGGCTCACATGTGTGGAGCTTGCAGATGCAGAAGTGGGGCTTCATGTGG
GGGCCCTGTTCCCTGTCTGTGCAGCATTTGTGGCTCTGGCAG
gtcagtggtctgtaggggtgtcctgggactgtggctcctctccccaggcaataggccagg
ggtaaggggcttgctggggtaggggacagcggtggcaggattggtggaatggctttgaga
atgacttctgggtgtactcaggctcctagatgtagatcagaggttgccatgctggccagg
EXON 13  131 bp
tatgtagcatctactggtaccctggaactgtgctgaactttatagctacacagatgacta
agacgcaatttggccttgccagttcatgactgagttatacatgaacagaacaagatcctc
atgaaacctctgatatgggtgagcttgtctaatctgtttttcccctttgtcttataacag
TGGCTCTGCTTTTTCTGTTGCGATGCTATTTTGTGCTTGAACCTAAGAGGCATGGATGCT
CTGTATCCAATGATGAAGGCCACCAAACACTGGTCATGTATAATGCGGAGAGCAAAGGCA
CTTCAGCCCAG
gtagtggaatgtcatgctttgtgtcttatggcaaggaattcactaatacacagacatata
gcatgtatttttccccccattgtgccacctcttaattcttcactcttacccgtgtttcag
tagcaagtgggaaaaaattcttgcaaatactatctaactcagataaatgaatttattctt
EXON 14  78 bp
tcttttcccacataagtcatccagatttacaggagaggtgtattttttacagtctggact
tcttctgtgatggcatagatacaatgtgttttggagaaaatgtcattcctttccttctgt
ttttatttctgctatctgtgatttcagcccttgtcatatttctttctctgtgttctacag
ACATGGTCAGATGTTGAAGGCCAGAGGCCGGCTCTGCTCATCTGCACAGCTGCAGCAGGA
CCCACGCAGGGAGTTAAG
gtaacatgccccttacttgcttctggatttcagagaagtgactttcctggtggtttccct
gacaaggaacacctgggatgctcctcccagtgccacatccagggaggttcttcttcaagt
cagcaaccccagcccctacttgcaaagccccatggttcccttagcctaaaacacccttgt
EXON 15  69 bp
ttccctgcctctcttcattttccttttcctcccaccgcgccctccctctcatcgtgttaa
tttgtgtttgcctatgaatatatgagcaaggggaagtggtgagaggtcacgcatgcccac
tttgtttccagctggagagaaatccattctcttttgagtaaatcagcattttccctctag
GATCTCGAGGAAGTGCCTCCATCTGCAGCGAGTCAGTCAGCCCAAGCACGCTGTGCTCTG
GGGAGCTGG
gtgagttccagaaggttgctccctgctacggccatctcactagtgactaacagttggtcc
ccctgagagagggccgttgtagaagattcggtgatactgtcagaaaaaggcacatagtca
atgaaaatctgagaagctgggctttttccacccgactctatttccatctatagaactagg
EXON 16  54 bp
cttcacaaagcaactgtgaaacttgttcatgaatttctgctatgaatatctacactcttt
agaattactatacctttagtacaaaaatgaaaggcaatatgactgcaagaatttctagtt
atgtatttgcatcctttggtaatttatttgaaatcagtaaatatttcatctttctttaag
GGTTATGGCAAGCCCTTTGAGCCAAGAAGTGTGAAAAACATACACTCTACTCCT
gtaagtatagatgtaggtgttaccgtgaacaaatttaccttattgttctgcctaaaagct
gtgcaaatccctgaaaattggaaatttggaaggaaagaggtgataaaaaaaaatatgccc
aacatccaagcaaactgaaggagaagcgaacgtgaagagaggttggaagtagttaaggca
EXON 17  75 bp
tccctctctcccccaacacaaagagaggaaacgtgagcaaactaccctgggcctggctct
tcacctccaagagaacggtgctcagtgtgccccatctatgctggggccactgacacacag
gggttggggggtaggacaagggctctgctgtggtatgaagctctactggtttgcttgcag
GCTTACCCAGATGCCACAATGCACAGACAACTCCTGGCTCCGGTGGAAGGAAGGATGGCA
GAGACATTGAATCAG
gtagggagagctccccttgtgctgtgcactagctatgggttttgcatccccactgtgctc
caggcttgatttggggacacttcctcctaaatcactgcattagtcagctaaggctgccat
aataaaataccatagcctgactggtggcttaaataacagaaatatattgcctcatgtttc
EXON 18  586 bp
atgtctcccctcagcatggctgccacttctggaactgtacgaactcctgtgtcagctgag
gacacggggcctgagtgctgttactactgcattgatgtgttcctcgaatcaaacctagag
aaatgagctgggtatggaagcacatggcatttaccttctctttcccccacttttccccag
AAACTCCATGTTGCCAATGTGCTGGAAGATGACCCCGGCTACCTACCTCACGTCTACAGC
GAGGAAGGGGAGTGTGGAGGGGCCCCATCCCTCAGCTCTCTGGCCAGCTTGGAACAGGAG
TTGCAACCTGATTTGCTGGACTCTTTGGGTTCAAAAGCGACTCCGTTTGAGGAAATATAT
TCAGAGTCAGGTGTTCCTTCCTAAAAAAAAAAGTCTATTTTGGAGAATTGAAATAATTCA
TGGAAGGGAATCACTATTCAGGGATTTTTCCCCTTTGCTCTTCTTTTCCCTCCTTAAAAG
AAAAATTACCTTCTAGTCCTAGGATGAGGACACACTATTAGTTTGAATTAAATGCTTTGA
TATTCTCAGATCAGCCATCTTGAACCAAAGCAAAACCACAAGTTACACTTTCTTAAAATT
TGATTTGTCATATTTTCTAGAGAAACTTGAATTTAATTGTGTTATTCTTAGCTTCCACTG
GCAGCCTAGCTTTGAGGGTAAATGAAAATATAACCCATAGATTACCCAGCCACTTGGGAA
CAGCAGGTAATACTGAAGAAAAATAAAAATAGATTTTGAAAACGTT
acttacatttctatgattatgattctgcttccatttaagggaaaacttaggtaaatagag
aaattttttctataacatttgtagtcagtatttgaagtgattttttaaaaaataagtatt
ggtccctgttcactttttgattagataaatagataaaatatgttatcttgagaaaaatga