Gene BMP2 Variant 1
DNA : 10.56 KbNT_011387
mRNA : 1547 bp NM_001200
CDS : 1191 bp NP_001191
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  316 bp
ctagcgcggagcgcccgaccctcgacccccgagtcccggagccggccccgcgcggggcca
cgcgtccctcgggcgctggttcctaaggaggacgacagcaccagcttctcctttctccct
tcccttccctgccccgcactcctccccctgctcgctgttgttgtgtgtcagcacttggct
GGGGACTTCTTGAACTTGCAGGGAGAATAACTTGCGCACCCCACTTTGCGCCGGTGCCTT
TGCCCCAGCGGAGCCTGCTTCGCCATCTCCGAGCCCCACCGCCCCTCCACTCCTCGGCCT
TGCCCGACACTGAGACGCTGTTCCCAGCGTGAAAAGAGAGACTGCGCGGCCGGCACCCGG
GAGAAGGAGGAGGCAAAGAAAAGGAACGGACATTCGGTCCTTGCGCCAGGTCCTTTGACC
AGAGTTTTTCCATGTGGACGCTCTTTCAATGGACGTGTCCCCGCGTGCTTCTTAGACGGA
CTGCGGTCTCCTAAAG
gtagaggacgcgggccagggcccggggtgggtggtgggtgggagggggatttgggcagcc
actgcggtagagcccttccttacgtccaggccagaagtaaacagacccctctccagtcca
cgtgcaacggagccctgcaggggctcccacttccagctgccccgggcgaccgtaagcctc
EXON 2  353 bp
gacccttcattatcccaaacgtttgagcttcggtcggtcttacctagactcgtgagtgtg
ccaagccaggagggcatcctggaggaggcacgccagccaaatgggagaccgggccgcggg
ggcgcgaggggggaggactgggcggggaactcgggtgactcacgtcggtcctgtccgcag
GTCGACCATGGTGGCCGGGACCCGCTGTCTTCTAGCGTTGCTGCTTCCCCAGGTCCTCCT
GGGCGGCGCGGCTGGCCTCGTTCCGGAGCTGGGCCGCAGGAAGTTCGCGGCGGCGTCGTC
GGGCCGCCCCTCATCCCAGCCCTCTGACGAGGTCCTGAGCGAGTTCGAGTTGCGGCTGCT
CAGCATGTTCGGCCTGAAACAGAGACCCACCCCCAGCAGGGACGCCGTGGTGCCCCCCTA
CATGCTAGACCTGTATCGCAGGCACTCAGGTCAGCCGGGCTCACCCGCCCCAGACCACCG
GTTGGAGAGGGCAGCCAGCCGAGCCAACACTGTGCGCAGCTTCCACCATGAAG
gtgaggcatggagcagggcgtgggggcggggagtcaccctgcaaagccctccaccgtggg
cagactgcagccgtccctgtagaggcagcttggccggggcaccagcggacgtttccactc
ttgcttctgtactatcgtttctgaatctgattttaactcactgcttgtgtggtgggggag
EXON 3  878 bp
gggaggctccatgtttatttaaagaggaaatttttattttctggttacctacttttacat
gggttacatcaaatcccacgatgaggtttaaaaattctcatagataatcaaacgtcatta
cttggcttactgaaattcagacttttcttttttcttccctgtttttctctatcaaattag
AATCTTTGGAAGAACTACCAGAAACGAGTGGGAAAACAACCCGGAGATTCTTCTTTAATT
TAAGTTCTATCCCCACGGAGGAGTTTATCACCTCAGCAGAGCTTCAGGTTTTCCGAGAAC
AGATGCAAGATGCTTTAGGAAACAATAGCAGTTTCCATCACCGAATTAATATTTATGAAA
TCATAAAACCTGCAACAGCCAACTCGAAATTCCCCGTGACCAGACTTTTGGACACCAGGT
TGGTGAATCAGAATGCAAGCAGGTGGGAAAGTTTTGATGTCACCCCCGCTGTGATGCGGT
GGACTGCACAGGGACACGCCAACCATGGATTCGTGGTGGAAGTGGCCCACTTGGAGGAGA
AACAAGGTGTCTCCAAGAGACATGTTAGGATAAGCAGGTCTTTGCACCAAGATGAACACA
GCTGGTCACAGATAAGGCCATTGCTAGTAACTTTTGGCCATGATGGAAAAGGGCATCCTC
TCCACAAAAGAGAAAAACGTCAAGCCAAACACAAACAGCGGAAACGCCTTAAGTCCAGCT
GTAAGAGACACCCTTTGTACGTGGACTTCAGTGACGTGGGGTGGAATGACTGGATTGTGG
CTCCCCCGGGGTATCACGCCTTTTACTGCCACGGAGAATGCCCTTTTCCTCTGGCTGATC
ATCTGAACTCCACTAATCATGCCATTGTTCAGACGTTGGTCAACTCTGTTAACTCTAAGA
TTCCTAAGGCATGCTGTGTCCCGACAGAACTCAGTGCTATCTCGATGCTGTACCTTGACG
AGAATGAAAAGGTTGTATTAAAGAACTATCAGGACATGGTTGTGGAGGGTTGTGGGTGTC
GCTAGTACAGCAAAATTAAATACATAAATATATATATA
tatatatattttagaaaaaagaaaaaaacaaacaaacaaaaaaaccccaccccagttgac
actttaatatttcccaatgaagactttatttatggaatggaatggaaaaaaaaacagcta
ttttgaaaatatatttatatctacgaaaagaagttgggaaaacaaatattttaatcagag