--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (43107 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (12 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1083       1448   0   Internal    366    50    Marginal
cgctacgaccccacctcttcgcggtcctctcagtctccctagcggggcaagggacccgcc
cagcgctttgctgatttgcccagcgctcacgcccaacctgggtttctccggagctcgccg
cgccccgcgcacccaccccgcaacggcagccgcacgtgggtctccccgcaaaccacccag
GCGTCCCGGGAGCAGCGCTGCTGCACGGCCGCGCTGGGGGCCCAACGCCTGGGGTTGCAG
GTGCAAAAGGCGCCCCGAGCCGGGGAGGCCAATCGCGTCCGCGGAGAACGCAGAGTGCGG
GCAGGGGCGCATCCCTCGCCACCCGCGGTCGCCCAGCACGCCGGGACGCGCGTGGCCATC
CAGCTCCCCGGGGGCGTTGGGGGGCTCCGCGGGCCTGGGCCTCGGGATTCGCCCGCCGCT
TCCCCGGGGAGCCGCTGCTGCAAAGCCAGGTTGGGGCGCCGGGCCCGGCCAGCGCCCTCT
AGGCAGCGGAAGTGCAGCTTGCTTTACATCCGTCCTCCCCGCCTCGCAGAGTTGGGAGAA
GGCAGG
gtggggggtgtggaaaaataaaaggaaaagtccttgcaccatgtagatcagcgtccccca
ctttggcatcccggccggccggggacctcccagtctgcggccatgaacgcgagcagcgag
ggcgagagcttcgcgggctcggtgcaaagtaagtgcttttccgggagcagtgcgcgctcc

Exon  2 +       1551       1596   0    Initial     46    78        Good
ccagcgccctctaggcagcggaagtgcagcttgctttacatccgtcctccccgcctcgca
gagttgggagaaggcagggtggggggtgtggaaaaataaaaggaaaagtccttgcaccat
gtagatcagcgtcccccactttggcatcccggccggccggggacctcccagtctgcggcc
ATGAACGCGAGCAGCGAGGGCGAGAGCTTCGCGGGCTCGGTGCAAA
gtaagtgcttttccgggagcagtgcgcgctccggggcccagtgcgcgctccggggcccgg
gcccaagcacgtctgcgacgcagccagcaggcccggggccccgaaatcggggtgacggct
cggagccgcgtctcggggaccgcggcgggcgcgctgtgcagggggcgccggagtgggctt

Exon  3 +       5061       5204   0    Initial    144    84        Good
aagaaaaagaaataatgtccctgccagttaggaatgaattttggctacaagtagcagaaa
cccaaattatactggcctaatgaaatctggaattgattgattgcagtgttgaatcaggga
aatcagtgaagtaaagggcagagcccatagggatcttggcatttttctcatagttacaag
ATGGCTGCAGAAGCCCCACCATCACATTTGCATCCAAAGCCAGAAGAAAAGGGGCACATT
GCTAGCCACATCTGCTCCCTTTTCATCACAAATGCCAAACTTTTCCCAGAAACTCCTCCA
GCTGTGTGCTGGAGAAGTTCACAA
gtatgtagaggaccaagattatttagactattggttctcatagtatgtgttttgggtgag
tatgtttggaaatgtgcgggaggatcagttttcacaattaccttttagttgggataggag
gtggctgctggttctgcaaagtgcaggacatcccttttatctttgataaaagaactttct

Exon  4 +       6122       6429   1   Terminal    308    92   Excellent
gctgctagggcacaattaggatgcagttcgcaggaagaggaaggtggagtggatactggg
ccactacccagccatgtctgccaccatgccttttcttcctaccatgaatctggtctgcat
tacaattcaaagctgtttggaattaatccgttactttccctttgtcccatggagttccag
GTGGCACAACGGTGCTGGTGGAGCTGACTCCCGACATCCATATCTGCGGCATCTGCAAGC
AGCAGTTTAACAACCTGGATGCCTTTGTAGCTCACAAGCAAAGTGGCTGCCAGCTGACAG
GCACATCCGCAGCAGCCCCCAGCACGGTCCAGTTTGTATCGGAGGAAACAGTGCCTGCCA
CCCAGACTCAGACCACCACCAGAACCATCACCTCGGAGACCCAGACAATCACAGGTACAG
CTGGAGCATGGGGGAGTCGGCCAGAATTGGCCTGGCTGTGTCTCAAACACGTCCATGGAA
CTTGTTAA
aaatatagattcccagagcccaccccctagggttgctgattcattatttttaacaagctc
caccaggaagccagctgcccagccaggtttgggagctgctaggttaaaacattaactgtt
agcagttataaatgttgtcacgttacaaaaaaaacagacaaaaaagagatttctgaaaca

Exon  5 +      20230      20347   0    Initial    118    77        Good
atcaaagctgtcttgagatgtctgaaaggcaatttggtagaaaaggagctatggttggtt
catgtgagccctaagactccacagagacaaacttcagagaaatagatgtggattatctat
ttcatgaaattcatataacagtcatacattttaaacaacatcatgatcaaataactgaat
ATGCCCCTGCTACAAACCAGAACTAAATACAATAAGCAATTCTCAGATGCACACCTGAAC
ATGCAGGAAAGAAGGGAAATCCCCTGGAGCCAGAAAACAAACCTGAAAGCTGCAGCAG
gtgtgtgaggctgtgagcttcttggggtatcggggacagggtctgatctcactaaacagg
aggcttgattttaatggccacaccagggtagaggctgaagccctgagctcttgcaaaaag
ttagacataagacccccacataaagaggtggcccgtgctgcattctcggtgaaaagaggg

Exon  6 +      22530      22577   0    Initial     48    67    Marginal
agggcagggatttttgtctctgagtcactgctctgtttctagtgcttagaacagttcctg
gcacacagtcagtacagtacctaataaatatttgctgaataaattagtgaataaagtcaa
cagcaacagcagctttacatgcctggtttctgatcctcacagcagccctaggagatagga
ATGGAAATTGTCCACATTCTCCAGGTAAAGAAACTGAGGACCAAGGAG
gtaagacacagcctaagctctggagcaaaccctttctggtctatagccatctactttggg
atgactcgcaggttacatgggattagccctgccccaaaatgatccctgcacctgggtgcc
tgaatccctttgctgttgggttttgtttttttttccttgagatggagtctccctctgtca

Exon  7 +      27174      27323   1   Internal    150    58    Marginal
tctctagtgtctcattagctagaactgggtcacatgatcactgtgaagccgcaagggagg
ctgggaaagcaaactagtacatgcattctctctacaaaggaaagtaggcagacaccatag
ctagcgggcatttatattaagaaaattaataatcaccatatcttttagtttcagctccag
AATTTGTTTTTGAACATGGCTATCAAACTTACCTGCCCACGGAAAGTAATGAAAACCAGA
CAGCCACTGTCATCTCTCTCCCTGCCAAGTCACGCACCAAAAAGCCCACAACACCACCTG
CTCAGAAAAGGCTTAACTGTTGCTATCCAG
gtaaaggcagcattatgtcctacttgtgtagagggtgtgatatttaaccaggctccaggg
ctcctcctcatgagttcctgacaactgctcatggatgtgttccaaactacctggcataaa
aatcagagccccctggcatttacatcagcacatacaacctatctcccactgtctgtggtc

Exon  8 +      28430      28500   1   Terminal     71   100   Excellent
gaaccacaaaatgacggtgtgtttttcccggtcatcacatatgaaggcacatgagatctc
tttttcccattaccgtggtgttaactcttgtcacttggttaaggatgtttctaccagttt
tctccatgctaaaagttactaagttttcctttgtaattaatctttcctttttttttttag
GTTGCCAATTCAAGACTGCTTATGGCATGAAGGACATGGAGCGGCATTTAAAAATTCACA
CGGGTAAGTAG
catttctttagcgcatatgccctcaacacctgctctgtgctaggagatggggatccacat
aggtcagacgaatgataccactccaaacgtcactggctgttatgggaatacaagtccaga
ttttaaaaaataaggtgccatttgtacacatgactttggcagaaaaatctttaacataat

Exon  9 +      32881      33064   0    Initial    184    76        Good
ggaatattcttcggtggttgtatatgacttttttcgtaaggcagtgggaaataagccttt
tccttttttaatcttgtttcctgctgccatctgtgtgtgtatgtgtttgaaggagacaaa
ccccataagtgtgaagtctgtggcaagtgctttagccggaaagacaagctgaaaactcac
ATGCGGTGCCACACGGGCGTGAAGCCCTACAAGTGTAAGACGTGTGACTACGCCGCTGCC
GACAGCAGCAGCCTCAACAAGCACCTGAGGATCCACTCGGACGAGCGGCCCTTCAAATGC
CAGATCTGCCCCTACGCCAGCCGCAACTCCAGCCAGCTCACTGTCCACCTGCGATCCCAC
ACGG
gtgagtcctgcctgttatttgctctctacgctcctcactttctatggcataaatcataag
caccttaaagcattcagccacaatgtaagaaatcgagttggaacctttgctcatcccgtt
gtttgcagttttgtttttttttgttgttgttgttttgtctcgctctgttgccctggctgg

Exon 10 +      34235      34442   2   Internal    208    52    Marginal
acaactctgttgatcttggcttggcttaaccacatgtgtggggaaggctgggtgcctttc
agatttccctggggatctgctggccatgggctggctggctgtccactggccttggctgag
gcaatctggttctgttctgtgcatctctcatcttcctcctgggaccatggactaacccag
GCTTGTCCTTCTCATGAGGATGGCAGAGGTGCAAGCAAGCAAGCCCCAGTGTAAGCCCAT
TTCAACTCTTTGCTTCTATAAGTTGTCAAGCATCACATTGGCTAAAGCAAGTCACATGTT
TCATCCTGGTGTCAAGGGCGGGACTGAGCTCACTGACAGTGAGAGGTCATCACAGTGTTA
CATGGCAAAGGTCGGGGATGCAGGGAAG
gtgaagaattgggactttttctttctttctttcttttttgagatggagtctcactctgtt
gcccaggctggagtgcagtggcgtgatctcagctcactgcaacctctgcctcctgggttc
aagtgattctcctgcctcagcctcctgagtagctgggattacaggctcacactgccatgc

Exon 11 +      39759      41041   1   Terminal   1283    90   Excellent
tccggggaaagataaagacgccctgcccctcttcccccactgccaggggctgctagaagc
tgcagttaggaggtctgcacccacccaccttgtataagcgattttctggtgtgtgcttcg
gggggatccgctgtggttgttgcctgcctgttcttatcgaaactcaccttgtgttgacag
GGGACGCCCCCTTCCAGTGCTGGCTCTGTAGCGCCAAGTTCAAAATCAGCTCGGACTTGA
AAAGGCACATGCGGGTGCACTCGGGGGAGAAGCCTTTCAAGTGCGAGTTCTGCAATGTCC
GCTGCACCATGAAGGGGAACCTCAAGTCGCACATCCGTATCAAGCACAGCGGGAATAACT
TCAAGTGTCCTCATTGCGACTTCCTGGGTGACAGCAAAGCCACCCTCCGGAAGCACAGCC
GCGTGCACCAGTCGGAGCATCCTGAGAAGTGCTCGGAATGCAGCTACTCCTGCTCCAGCA
AGGCCGCCCTGCGCATCCACGAGCGTATCCACTGCACCGACCGCCCTTTCAAGTGCAACT
ACTGCAGCTTCGACACCAAACAGCCCAGCAACCTGAGCAAGCACATGAAGAAGTTCCATG
GGGACATGGTTAAGACTGAGGCTCTAGAGAGGAAGGACACCGGCAGGCAGAGCAGCCGGC
AGGTGGCCAAGCTGGATGCCAAGAAGAGTTTCCACTGCGATATATGCGATGCCTCCTTCA
TGCGGGAGGACTCGCTCCGCAGCCACAAGAGACAGCACAGTGAGTACAGTGAGAGTAAGA
ACTCGGACGTGACCGTTCTCCAGTTTCAGATCGACCCCAGCAAGCAGCCCGCCACGCCCC
TCACTGTGGGACACCTCCAGGTGCCCCTCCAGCCCAGCCAAGTGCCCCAGTTCAGCGAGG
GAAGAGTCAAAATCATCGTTGGGCATCAGGTGCCCCAGGCGAACACCATCGTCCAGGCTG
CCGCCGCTGCAGTGAACATCGTCCCGCCTGCCTTGGTGGCCCAGAACCCAGAGGAACTCC
CAGGGAACAGCCGGCTGCAGATCCTGCGCCAGGTCAGTCTGATCGCCCCCCCTCAGTCCT
CGCGGTGTCCGAGCGAGGCGGGCGCAATGACCCAGCCGGCTGTCCTGCTGACCACCCACG
AGCAGACGGACGGAGCCACTCTGCACCAGACTCTCATCCCCACGGCCTCAGGTGGCCCCC
AGGAAGGCTCTGGCAATCAAACTTTCATTACCAGTTCGGGTATTACTTGCACTGACTTTG
AAGGCCTAAACGCCTTGATTCAGGAGGGGACAGCAGAAGTGACAGTGGTGAGCGATGGAG
GCCAGAACATCGCAGTGGCCACCACAGCGCCACCGGTCTTCTCCTCCTCTTCCCAGCAAG
AACTACCCAAGCAGACCTACTCCATCATTCAAGGGGCAGCCCATCCAGCTTTGCTCTGTC
CCGCCGACTCCATTCCAGATTAG
tgcttaaaaaaacaaaaggagtgggggaaaggaattgagaaaaagaaatcttaagtagaa
ttctctaaaaggtttgctcttaatgttttctttgttttgttttgtttttgagacggagtc
tcgctctgtttcccaggctggagtgcagtggcgctatcttggctcactgcaacgtccgcc

Exon 12 +      39827      41041   0     Single   1215    83        Good
ggaggtctgcacccacccaccttgtataagcgattttctggtgtgtgcttcggggggatc
cgctgtggttgttgcctgcctgttcttatcgaaactcaccttgtgttgacaggggacgcc
cccttccagtgctggctctgtagcgccaagttcaaaatcagctcggacttgaaaaggcac
ATGCGGGTGCACTCGGGGGAGAAGCCTTTCAAGTGCGAGTTCTGCAATGTCCGCTGCACC
ATGAAGGGGAACCTCAAGTCGCACATCCGTATCAAGCACAGCGGGAATAACTTCAAGTGT
CCTCATTGCGACTTCCTGGGTGACAGCAAAGCCACCCTCCGGAAGCACAGCCGCGTGCAC
CAGTCGGAGCATCCTGAGAAGTGCTCGGAATGCAGCTACTCCTGCTCCAGCAAGGCCGCC
CTGCGCATCCACGAGCGTATCCACTGCACCGACCGCCCTTTCAAGTGCAACTACTGCAGC
TTCGACACCAAACAGCCCAGCAACCTGAGCAAGCACATGAAGAAGTTCCATGGGGACATG
GTTAAGACTGAGGCTCTAGAGAGGAAGGACACCGGCAGGCAGAGCAGCCGGCAGGTGGCC
AAGCTGGATGCCAAGAAGAGTTTCCACTGCGATATATGCGATGCCTCCTTCATGCGGGAG
GACTCGCTCCGCAGCCACAAGAGACAGCACAGTGAGTACAGTGAGAGTAAGAACTCGGAC
GTGACCGTTCTCCAGTTTCAGATCGACCCCAGCAAGCAGCCCGCCACGCCCCTCACTGTG
GGACACCTCCAGGTGCCCCTCCAGCCCAGCCAAGTGCCCCAGTTCAGCGAGGGAAGAGTC
AAAATCATCGTTGGGCATCAGGTGCCCCAGGCGAACACCATCGTCCAGGCTGCCGCCGCT
GCAGTGAACATCGTCCCGCCTGCCTTGGTGGCCCAGAACCCAGAGGAACTCCCAGGGAAC
AGCCGGCTGCAGATCCTGCGCCAGGTCAGTCTGATCGCCCCCCCTCAGTCCTCGCGGTGT
CCGAGCGAGGCGGGCGCAATGACCCAGCCGGCTGTCCTGCTGACCACCCACGAGCAGACG
GACGGAGCCACTCTGCACCAGACTCTCATCCCCACGGCCTCAGGTGGCCCCCAGGAAGGC
TCTGGCAATCAAACTTTCATTACCAGTTCGGGTATTACTTGCACTGACTTTGAAGGCCTA
AACGCCTTGATTCAGGAGGGGACAGCAGAAGTGACAGTGGTGAGCGATGGAGGCCAGAAC
ATCGCAGTGGCCACCACAGCGCCACCGGTCTTCTCCTCCTCTTCCCAGCAAGAACTACCC
AAGCAGACCTACTCCATCATTCAAGGGGCAGCCCATCCAGCTTTGCTCTGTCCCGCCGAC
TCCATTCCAGATTAG
tgcttaaaaaaacaaaaggagtgggggaaaggaattgagaaaaagaaatcttaagtagaa
ttctctaaaaggtttgctcttaatgttttctttgttttgttttgtttttgagacggagtc
tcgctctgtttcccaggctggagtgcagtggcgctatcttggctcactgcaacgtccgcc

--------------------------------------------------------------------------------