--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (28643 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (7 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       5207       5352   1   Internal    146    94   Excellent
tgaggtgtggctgccctcgtctactgcccatgctgtcctcacagacctttcagagaagag
gtgttagtctccagggtctcacccactcccacctgtgcttttgtcctgctagagacctct
accgtatttacttggaactaacttatttgacactttgtggcctcattttgtctctggcag
ATATCAACCTGAATTCTCCTAACAAAGGTCTGCTGTCTGACTCCATGACGGATGTTCCTG
TCGACACAGGTGTGGCTGCCCGGACTCCTGCTGTTGAGGGTCTGACAGAGGCTGAGGAGG
AGGAGCTCAGGGCTGAGCTTACCAAG
gtgctgtggcttggctgtctgtcctggggtgaattggagttaaggccctcttggattagt
gagaggccagggtactggccacgctcgggaggaattgccctgggtggtcacctaccctgc
tctgtgttccgactgataacggggttctctttgtatgtgcccagctccatgcactggact

Exon  2 +       9579       9691   0   Internal    113    90   Excellent
aaaaaaaaaaaaaaaccaaaacccaaaaatcagatgtctgctgtagatgctgttattcct
aggacgagttaatgctttggtaagcggaaagttcttgtgtaactcatggcactgtgcatg
aggatgttagtcacttcctgcagtagtgatggctcatcatgtcaactgcatgctttgcag
GTGGAAGAGGAAATTGTCACTCTGCGCCAGGTCCTGGCAGCCAAGGAGAGGCACTGTGGA
GAGCTCAAGAGGAGGCTGGGCCTCTCCACCCTGGGGGAGCTGAAACAGAACCT
gtccaggagctggcatgacgtgcaggtctctagcgcgtaggtacctgccccaggcgcacc
cctgggggctgaagagaacgggcaccacacgtgccccggcatgtgggggggcgtcgtcat
gcccagggacgagttgcagccgtggagttgagtggcctgtttggaaggatccagagagag

Exon  3 +      11116      11171   1   Terminal     56    95   Excellent
tcggctactagggaggctgaggcaggagaatctctttaacccgggaggcggaggttgcag
tgagccaaaattatgccactgccctccagcctgggtgacagagcaagactctgtctcaaa
aaaaaaaaatatatatatatatatatttatatataggaccatatggtcccacaaccctag
GGACTCTGACCCTCCCCGATGACGACGTGGTCCTACATGACGACGTGGTCCTATAA
ccctgggacacctgtcccagatgtcgctcagctctgaatttggggagtgctgctttctca
cttggccctgtccacgtggcttctctgaaacatacccttcaaggttggggtggctgtgga
atgtttcccagaagacatgttcctatacaaagacagaacaggtcacatttcataaatctc

Exon  4 +      11727      11786   2   Internal     60    82        Good
ggcggcctggggcctgcacagggcctggttgaggcagtggaccccatttttgggccgtct
gtggagttgatgttcctgccagctggtccctctctgtcttccctggaacttcacctgcag
tttgatgcctgagttaaaattgttcttctaaataattcactgtagactttctgtttttag
CTATGTGAAAACTTCTGAGAAACTTGGAGAGTGGAATGAGAAAGTGACCCAGTCAGACCT

gtgagtgcctgtatcatcagcacctcctccttcctcctctccgcctcctgacactcagtc
ggggaagggggctgtgcacacttggcacaaagcttgttttggtatttgctggctattttt
tcttcctataacttttcttctctcaggtaaactatcctttaaacttttgtggaacaggga

Exon  5 +      14093      14145   2   Internal     53    55    Marginal
gacggaagggatgcggcttgggaggtggggcctgaggatgtggccatggcgcgtgctctt
cctggctggtgcctctcctagtcagcttcaggagatgggctgtagatgtacctccactgc
ccagagctctgcaggggaaggcagtaaaagctccctgcatcctgacccacgtgtttgtag
ATCCTTTCAGCTATTGGCGCCCTGGAGGATGGACGGGAAGGAGAACGTGGCCG
gtgggtggaggatagcactggtgcctggccccatgaggctgcaatgcggccacattctca
gtgggtcatgtctgaatgcgagagcagctgtgttctgcgagtggtgaaacaattgcctgt
tgcattctatttataggcagaggtaactaaaaacctcagtgctgagaggggcatcatata

Exon  6 +      18630      18731   2   Internal    102    66    Marginal
ctctgggggccgaggggctctgggcctgcaccccctctgtagacacctggcgagtgtcca
ccccttggcccagctcctttcctcagttttcctcgggcgtgctcccagtgctttgtttgc
ttggctgtgggtggtgacccgcccatgctgtctggttgatttaactggtgtgtcttccag
CTACAAGAAGACTCAGGAAACTCTTTCACAGGCAGGACAGAAGACTTCAGCTGCCCTGTC
CACAGTGGGCTCTGCCATCAGCAGGAAGCTTGGAGACATGAG
gtgagacgcaaccctgactctgctgccctgagacctggccaggagtgaggtgaggtgttg
gaggtgctacaggaagcctgcctggagatcagggctcagatgcactggctcagggatgtg
gccatccatcatggccccgaccagtctgtgtgcagacccttgcctgggaggttcgtccat

Exon  7 +      23520      23561   0    Initial     42    42    Marginal
aggggcaggcagctcgctccaactgctgggagtgggggaatcccagctctgcccatccct
gccaagttggggttgtgtgtggatcttggtgttaactcttgcttccttctctgcttctgc
catgcttccaagcagcagctactccatccgccactcaataagtatgccagccatgaggta
ATGTATGCCTGCTCGCTGCGGCTCCAGAGCCGGGTGTCTCTG
gtgggggttggggcagctcccgccggttacaccttgcccttcccatattcctggattaat
tgaggactccattcccttggcaacctctgatgactaagggccggtaaaaaccccctctag
gctgacgaggaagagctggtagggggtcaggctcttcacctgcagcctccagaggagatc

--------------------------------------------------------------------------------