--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (38475 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (14 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       3982       4164   0   Terminal    183    55    Marginal
ttgtctcatacatgtaataaatgttttaaaatacttttttgaaatcaagatccaaataga
tcaatacatcacaacgggtttaagtttctctttataggttctctcttcaatgtttttttc
attttctttcttgcaatctatttattaaagaaaccggaccctttgtcaataatttcccag
TATATGAAGTTTGTCAACTGCATCCTGGTTCTGTGTTTAACTTGTTCCTCAGCCCTGGGT
ATTTCCTGTAAATTGAACATTGGATCTAAAGGCAAAGGCCATGTAATTGACCTGTACCAA
ATACTGCCCCTGCTTAAACCAAAAGAACCCTCTGATAGCAATAGAATAGCTCGTGTTTAT
TGA
gtatttattacacaacagacattgtactaagtgttttacatgcattaattcatttcttgc
tcacaccagccctgggaggtagatactgctggtcccatggctgctggaggtcacacagct
aggaagtgccacagggggtcacgaccttgtgattaaaagatttaggcaaagctgggcact

Exon  2 +       4767       5025   0    Initial    259    71        Good
tcacaccactgcactccagcctgggcaacaaagcaagaccttttctcaattaaattaaaa
agaaaaaaaagagttagggagattgggccccacctagcccccgtgtgaccagggctgggg
agacaggtcagtcgaaacaatggctgtgctttgtggggagtaagagggcacaaggccccc
ATGTCTAGGGAGGGCAGGTGCATCACTGGAGGTCTGAAGGATGCCCCCGAGGCTCATGCG
TCTCCTTCTGTTTCCATAGAGCTGGTCTTAGAGAGGTGTGATCTGGAGCTGGAGACCAAT
GGCCGAGACCACCACACGGCCGACCTGTGCCGGGAGAAGCTGGTGGTGCGACGGGGCCAG
CCCTTCTGGCTGACCCTGCACTTTGAGGGCCGCAACTACGAGGCCAGTGTAGACAGTCTC
ACCTTCAGTGTCGTGACCG
gtgagtacctgcaaccccactccaccaccaccaccaccaccaccacttcctctccacccc
gacatgccccagaaccctgacagagaacaggacaaataactttaccttctttgttccctg
ggagattgccacctgtcatcagccccattttagagatgagggaactgaggcccggaaagg

Exon  3 +      10356      10598   1   Internal    243    97   Excellent
ctgagcccccctttacagatgaggaaactgaggctcagggagacaaacttcttgccaaac
ttatttcagtggttagtggcagaactaggcctggagcccaagctgggggaccccacgtag
gtgccctgccctgccagccctgctacccctagctcacggctactgcttctccctccacag
GCCCAGCCCCTAGCCAGGAGGCCGGGACCAAGGCCCGTTTTCCACTAAGAGATGCTGTGG
AGGAGGGTGACTGGACAGCCACCGTGGTGGACCAGCAAGACTGCACCCTCTCGCTGCAGC
TCACCACCCCGGCCAACGCCCCCATCGGCCTGTATCGCCTCAGCCTGGAGGCCTCCACTG
GCTACCAGGGATCCAGCTTTGTGCTGGGCCACTTCATTTTGCTCTTCAACGCCTGGTGCC
CAG
gtgagccacacgccatccactcacagcgttggggtgggcagggctggatccgcccatgga
ggaggctactggaggtgagaagaacaggggataagagacacacatcaaagtggactgagt
gaggcccactgtgctccagcctcacaaaaccctcaagacatgagtactcctgttatccct

Exon  4 +      15388      15506   1   Internal    119   100   Excellent
ataacaccttatctcattgacgtgggattattcattaatggttactttttctaattaaaa
gaaggatggatccctgagacgctggcttggcctagggaattggcacccttgactccagat
ttgcagggaccctgggcctccgcagacccagagctgaggtccctttcttcctgcctgcag
CGGATGCTGTGTACCTGGACTCGGAAGAGGAGCGGCAGGAGTATGTCCTCACCCAGCAGG
GCTTTATCTACCAGGGCTCGGCCAAGTTCATCAAGAACATACCTTGGAATTTTGGGCAG
gtaagggccacaccctgtctctcccaaccatctcaggcccttctgtgtgcccggccctgt
gtctgggggcagccaaagctgcacaggtgggagtgagtcacagagtcacccacttcatgc
tgtcagggatgcaaaggccctgaaacagctgaaggttcagagagggccaaggctgccctg

Exon  5 +      18356      18472   0   Internal    117   100   Excellent
ctccattccctcctgtgccaagagaagctgccaccagagagatttggtagactcggccgg
agtgtcccagtctgctgtgtgggacagagtgggaaacagctgctggaggcttcaacgcag
gcttcctggaggaggtgccttcccagctccctctttctcctcttgtttcctctgacacag
TTTGAAGATGGGATCCTAGACATCTGCCTGATCCTTCTAGATGTCAACCCCAAGTTCCTG
AAGAACGCCGGCCGTGACTGCTCCCGCCGCAGCAGCCCCGTCTACGTGGGCCGGGTG
gtgagtggcatggtgagtgagtggcatggcccatccaggggcggggcctacagggggctc
ccgcaggcctctccctcgcagtggagacacaggctaggcgcggtgggggacccgggagat
gggtaagtcttggggaaaagaccttatattggaaagataagatttgcacagatgagggtg

Exon  6 +      19551      19728   0   Internal    178    97   Excellent
ccagcccccaccatctgccgcacaccagtctgtcacacgatggcccctttgcacctgctc
tttcctcaccctggagctcccctccccagctttcaccccctgctgtactcaggctcaccc
aggcggcacagccgacaccccatcccaggctcagtccccgtgctgccccactggttgcag
GTCAACTGCAACGATGACCAGGGTGTGCTGCTGGGACGCTGGGACAACAACTACGGGGAC
GGCGTCAGCCCCATGTCCTGGATCGGCAGCGTGGACATCCTGCGGCGCTGGAAGAACCAC
GGCTGCCAGCGCGTCAAGTATGGCCAGTGCTGGGTCTTCGCCGCCGTGGCCTGCACAG
gtgagctgcacgctgggatgtgggtcatgagccctgggagggggcacgaagagcactgga
gtaggaatcaggacatccctgccctggtcctgccccctgccaccaacactctcaatgcgc
tatgtggcctagagcctgtgaccaccctctccggtcctttatccaatagccatccctcca

Exon  7 +      24246      24381   1   Internal    136   100   Excellent
gaatggacatggggtgaccagagaggtgggcgccattgtcccggcaggaagggctggctc
atgttctcagcacttggacagcaggtacagtgttccctggaatgcagatgggcaggtgga
ggcccagagcagggcggatgtctccaggacctcaccccgctttccactcctctccaacag
TGCTGAGGTGCCTGGGCATCCCTACCCGCGTCGTGACCAACTACAACTCGGCCCATGACC
AGAACAGCAACCTTCTCATCGAGTACTTCCGCAATGAGTTTGGGGAGATCCAGGGTGACA
AGAGCGAGATGATCTG
gtgaggtgggggccagggtgggatcggagcccagtagggagggccccatggagaggaaac
cttggagggcttcttggaggaggtcacatttgaattgggccttaaaagttcagcagtatt
tgagcaggcttggggaaggcctagagggaaagtcaaccacatacatgatggggcctcagg

Exon  8 +      25060      25163   2   Internal    104   100   Excellent
gagggtgctgtgagatgggcccccgtggggggaagaacaaggcagtggggagacaccctg
ggctcagtttgggacgaggcgagcttgcatctggggacatgaatgcatggtctgcccgtg
ggaggtggcgatgaatgttgctcatgttctgcttcattcccgcccccctatccccctcag
GAACTTCCACTGCTGGGTGGAGTCGTGGATGACCAGGCCGGACCTGCAGCCGGGGTACGA
GGGCTGGCAGGCCCTGGACCCAACGCCCCAGGAGAAGAGCGAAG
gtgcgtgggcgggcactgtcgcgtcaaacagatggggaagacgaggcttggagagttaaa
gtgactcagctggagggcggcagaactaggagctcacccggagaccactgatgggtccac
agaagggtgggggacctcacttacatcttaataacacacttcttgataaatctcaaaaat

Exon  9 +      26791      27033   1   Internal    243   100   Excellent
ctccagagcccctattctgaacccttgccctgtggtgccctcctggaagtggagtccttc
cgtcagagggccgcgtggtcttgaggtttttggctacatgtgattgaattgtggagcgtt
ttagaggacaccacccaaccttcacccaggcccatcccttcccctttctacctctgccag
GGACGTACTGCTGTGGCCCAGTTCCAGTTCGTGCCATCAAGGAGGGCGACCTGAGCACCA
AGTACGATGCGCCCTTTGTCTTTGCGGAGGTCAATGCCGACGTGGTAGACTGGATCCAGC
AGGACGATGGGTCTGTGCACAAATCCATCAACCGTTCCCTGATCGTTGGGCTGAAGATCA
GCACTAAGAGCGTGGGCCGAGACGAGCGGGAGGATATCACCCACACCTACAAATACCCAG
AGG
gtatgtgccctcagagtctttaatgcagccttgaagataagcatccagttttcccagccc
ggcaggctcgtgtatgtgtgtgcgtgtgttttaattggtagcctacgtacagcaatggcc
ccgtaggctatactccatcttcagcaatgccttagaaacaggagcaaacatgttgaggga

Exon 10 +      28060      28332   1   Internal    273   100   Excellent
gagttcactagtggaaaattaatgaaatgctgtgtccttctggcccagaaatgtagagaa
ggggctccttcatggctgccctgagtcatcaggcctctgcgaagacagctcgccctgttg
cagcccccttcctgtgatctattccagctgtgattgaggctctcttctcaacccctacag
GGTCCTCAGAGGAGAGGGAGGCCTTCACAAGGGCGAACCACCTGAACAAACTGGCCGAGA
AGGAGGAGACAGGGATGGCCATGCGGATCCGTGTGGGCCAGAGCATGAACATGGGCAGTG
ACTTTGACGTCTTTGCCCACATCACCAACAACACCGCTGAGGAGTACGTCTGCCGCCTCC
TGCTCTGTGCCCGCACCGTCAGCTACAATGGGATCTTGGGGCCCGAGTGTGGCACCAAGT
ACCTGCTCAACCTCAACCTGGAGCCTTTCTCTG
gtaaagccctgtgttcctggagcatttgttgaccgccaactgacaacatgctaggtagtg
acctaaccacttagcatgtgtgatttcaccccacagacacttacatggcgctgactctgg
ggcaggccctgtcctaagcactttataaatatcaacccacttaattcttattgcaagagt

Exon 11 +      33945      34105   1   Internal    161   100   Excellent
tctccagctcctcgctgggaaccctggagccacagtggggagttcagggatccgcccagc
cattcccccgctgtgtgaccccaagcacattccttcccctctctgtgcctcttggagttg
caagagagttgggaggggtgattctgcatcatgagcaccctcctttctccccttctgcag
AGAAGAGCGTTCCTCTTTGCATCCTCTATGAGAAATACCGTGACTGCCTTACGGAGTCCA
ACCTCATCAAGGTGCGGGCCCTCCTCGTGGAGCCAGTTATCAACAGCTACCTGCTGGCTG
AGAGGGACCTCTACCTGGAGAATCCAGAAATCAAGATCCGG
gtaagggcaggctgggcaaggggcagggtcccagggcagctcagcgctggggagagggca
gatccctacccccaccccacacacctgcatccctgcaagctccagacctttggtgcctta
gcgatcctcaaatcctagcctcatcgaagaaaagcatcatgaagcctagagaattgggga

Exon 12 +      35216      35352   0   Internal    137   100   Excellent
tagcacaatcggtgttttcccgatgaagaaactgaggcacagaggtggggggaggggggg
tgatcgtggcagacctgggtacagctttgttcagcaaatattgggccaaattgcagtgaa
tgcagacagcccagcctggatcccacctgcccttgacatctgccccatgccctcttccag
ATCCTTGGGGAGCCCAAGCAGAAACGCAAGCTGGTGGCTGAGGTGTCCCTGCAGAACCCG
CTCCCTGTGGCCCTGGAAGGCTGCACCTTCACTGTGGAGGGGGCCGGCCTGACTGAGGAG
CAGAAGACGGTGGAGAT
gtaagtgctggctgctctagctttggggcctgggggaagcgggcagatgccggtgggggt
agagactgtccttaggtaccaagccctggctgaaaatcccctcctctcatctcccacaca
gctgtgcccactcccagacaccctggggctagagttcccaccgtcacattctctgtcaat

Exon 13 +      36076      36205   2   Internal    130    96   Excellent
cacaggcactgttcactctaggagggcagattgtccaggccccgcagagggccgagaatg
aggcccattcatggacacgctgtgctgatcctcggaggtcacgtgacttcctggctggac
cccagcatgcgggagccaggccttgggcccctttcctcaccaccccctctctccctgcag
CCCAGACCCCGTGGAGGCAGGGGAGGAAGTTAAGGTGAGAATGGACCTGCTGCCGCTCCA
CATGGGCCTCCACAAGCTGGTGGTGAACTTCGAGAGCGACAAGCTGAAGGCTGTGAAGGG
CTTCCGGAAT
gtcatcattggccccgcctaagggacccctgctcccagcctgctgagagcccccaccttg
atcccaatccttatcccaagctagtgagcaaaatatgccccttcttgggccccagacccc
agggcagggtgggcagcctatgggggctctcggaaatggaatgtgcccctggcccatctc

Exon 14 +      37916      37960   0   Terminal     45    66    Marginal
gatcacagcctccagggccccccaaatcccagggaaggacttggagagaatcatgctgtt
gcatttagaactttctgctttgcacaggaaagagtcacacaattaatcaacatgtatatt
ttctctatacatagagctctatttctctacggttttataaaagccttgggttccaaccag
GCAGTAGATGTGCTTCTGAACCGCAAGGAGCAAACACTGAAATAA
aatagtttatttttcacactcaaactaggtctggtctgttcctttatgagtttggaggga
gatgggtaggtgagctcgctcacacctggacccccacttcctgcctaggagtctttcctg
agcctcagccctgtccctgcgtttaaactttactggcattcaaggtcctacacaggctgg

--------------------------------------------------------------------------------