--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (60873 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (25 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       2174       2317   0   Internal    144    88        Good
aatttctaattcagttgttccaaatttaatagtggccatatttttaaaaaatacgtgaat
taatattttatgagttcatttgagagttttcatgtgaaaacggttctcaaattactagat
tgcataaggtaattaattttggttttgatacagtatgtgccattaaatatatttctctag
CAGTTGGAAAAATGCATTGATGATGCTTTAAGAAAAAATGATTTCAAACCTTTGAAAACA
CTTTTGCAAATTGATATTTGTGAAGATGTGAAGATTAAATGCAGCAAACAGTTTTTCCAC
AAGGTGGACAACCTTATATGCAGG
gtaaatattcatttttgctgaatgattgttacaattattagatagaactctagttttaga
aggaagtactccattagaaaaaaatgaataggcttgggcaagctcagtcataattatata
aataaatgcttatttcaccatttgcttattattgtttgtttgtttgaggaatctcaacac

Exon  2 +       7056       7207   1   Terminal    152    80        Good
cccaggctggtctcaaactcctgggctcaagcagtctacctatctgggccttccaaagtg
ctaggattataggcctgagttaccatgcctggcccctttccactaactcttataagaaaa
gactgacagttaagaggatttgaaatgaacatttatcaataatttaacacttttattcag
GTAAAAAACAAGTAGTGGAAAGTTTCGTACCTCGCATTTGTTCCCTGGTTATTGACTCAA
GAGTGAATATTTGTATTCAGCAAGAGGTAAAGTCATTTATTTGTGTTTTAAAAACTAAAA
ATGAGAACGTGAAGAAAATCAATAGCAATTAA
attgacaatttatttcatgtaggacaaaattacttagcttggagtatatttctatcataa
tctattgcctgacatatttccgaaatacttactgaaaatttataaccatatgggtttatg
tgtgcatatagctcaagtggaaataaattataccaaccagatttttggggtgcttaagta

Exon  3 +       9376       9518   1   Internal    143    97   Excellent
tgttaattcctcaaatgatgagatatttctaatccatatgaagaaaatattaatagatta
atcaattacattaatatattcttatttctcttgcttattctaataccttgtaaaatatat
ggtcttttataaacttaattttcataattgtaaatcaaacattaactatttttttaatag
ATTATGACTTACAGGTAGGCATTGTAGAAGCTTTGTGTAGAATGACCACAGAAAAACAAA
GACAAGAACTGGCACATCAGTGGTTTTCAATGGATTTTATTGCTAAGGCATTTAAAAGAA
TTAAGGACTCTGAATTTGAAACA
gtaagttgtataacaataacagaaattcgtgaatttttaaaaattattatgatttttaaa
agtatttctctttaaaattaggattgcaggatatttctcaaccttgtaaatggcatgctt
ggagacaaaagaaggtaaacttaatgcaagatacaaccatttactgtcaaataaatagag

Exon  4 +      10691      10999   0     Single    309    40        Poor
cttatttaagttctatggaaacaataagctaagttaggaaactctgctcatatttgatag
cacactgtattagtctgttttaatactgctgataaagacatactggagactgagacattt
aaaaaagaaagagatttaattggacttaaagttccatgtggctggggaagcctcactatc
ATGGCAGAAGGCAAGGAGGAGCAAGTCCCATCTTACGTGGATAGCAGCAGGCAAAGAAAG
AATGAGGAAGATGCAAAAGGGGAAACCCCTGATAAAACCATCAGATCTCGTGAGAGTTAC
TCACTACCGCAAGAACAGTGTGGGAGAAACTGCCCTCATGATTCTGTTATCTCCTACCAG
GTCCCTCACACAACACATGGGAATTATGACAGTACCATTCAAGACGAGATTTGGGTGGGG
ACACAGAACCAAACCATATCACACACAAAAACATTTGGTGCAATCATTTTAGTCAGAATG
GTAGATTGA
gtagtattgtcaaagtaatatgattttctctacataaatgtccactaaacatgtattttg
aaaagtattaaagagggaaatatgattttatttcaattattatgaccactgcctgatttc
cttttgattctaggcatgatttctattactggacaagattatgctgtgaaagcttattta

Exon  5 +      11782      11877   0   Internal     96   100   Excellent
tattaaagtagcatttcatttgattgtttttaaatttatctaaatattatacttgtctgt
tctttctcttctctctccttctagctttgttttcttgctttagccatgaatataacatca
taattgtctgttatttctaaaatcattgtatattccagttttgtatgtttattttattag
CTGCAAATACCATCAGATGAAAAACTTGAGGAATTTTGGATTGATTTTAATCTTGGGAGT
CAGACTCTCTCATTCTACATTGCTGGAGATAATGAT
gtaagtttaatttggttggtattattctttatgtatatgcatatataagatttttactta
ctttaagaatgtggatttctttatatgttctagccagtctttacctagattttaatatta
gctctagtagtttgattagcatagcaacctaccaagctaattataaatgaaaactacttc

Exon  6 +      19197      19386   0   Internal    190    82        Good
ttttatgatagataatgcatatacaggaacaatagatgctccagataatccttccaccag
aagagtttcttttttcttcttaggcagaggggctgaaggactgatccagtcatggatgtt
ggtctgtgtttagttctagttttaaatttactctttgtcttgtttgcctctattactcag
GTGTGGCCATCCCAGTCTGTTGATGATGAGCCTATTAGATTTGTGTCTTCTGAACCTGAG
AGACTGTGGAAGATACAGTTCTGCCTCTTAGAGGTTTCCAGCTCAGCTCTCGAGCCGTTC
ACTCTACTCAGTCCAAAATCTGGCAGATATTTTGAACGGAACACTGAGTATATGCCTGAG
GATGATACCT
gtatcaggcagtacattgattccaagcccatgagactataagagagttaactgcctttta
tcaggtttggtccagctccttgtgctgccccagaatgaagggaaaattagttatgccttt
aaagcttttaagtgtcctatttgttactccaggcattactgctcactaaatacttgcttg

Exon  7 +      23343      23489   0   Internal    147    87        Good
gagtttgaaaaaatggatactttttattggatcactttgtaaaaattataacagcacatg
gatagaaaagggaaataattgaatatgtgagatgagtaggagcttaagacatccagtgat
tgttgattactttctgtggtttgcagttttaaatactttttttttcatattctccaacag
ATTCTAGTGCCAGAAAGTCAAATCTCACCAGTCGGAGAAGAGCTCGTTAGTTTAAAGGAA
AAATCAAAGTCCCCAAAGGAATTTGCTAAACCTTCAAAATATATCAAAAACAGTGACAAA
GGGAATAGAAATAATAGTCAGCTTGAG
gtaaagatggtgtcaaaatactggcttataaaactaccattgatcaaatcactgttatat
atgagtactgaaagaagcatctagaatttatatattattggccttgatcaatcacatttc
agagtgtttctcctacctttgacaaatgcaaacaaaagatagtgtgtgtcttagcaaatt

Exon  8 +      30034      30103   0   Internal     70    85        Good
tgtgtttcaggatagggaatattcaaaaacgggcataacgtttatgaaatatataaaaat
agtatccaacttttcatatcaaggcagatttgttttaaaagactcaaaccttaatactgt
aacatttaggttttcatataacatcttaagtttacgttaacctgtttcctgtgtttacag
CATATCAAAACTGCTAAGTGTGTAGAAAACACAGAAAATAAGAATGTTGAATTCCCAAAC
CAAAATTTTA
gtaagtaccttgtggtttaatttagtcatttttttaagaaaatgtatatacttctccctg
tattaccatttaaccccactggctttcattgatttgaaaaagatttacaaagaatttgtt
tgactttgtgcaaggaatttttgaggttacaaggaaatataccacctttgttccccagaa

Exon  9 +      30428      30485   1   Internal     58    59    Marginal
ggttacaaggaaatataccacctttgttccccagaagtttgggtttaagagagaggatgc
aaaatcgatcaatccgttcatcccaatatgtgaacctttatagatttctatactaacctc
cctatccccctgccaactgcatgaaaaaaatgaaaatattataatatttgttttatttag
GTGAACTCCAGGATGTTATACCAGATTCACAGGCAGCGGAAAAAAGAGATCATACTAT
gtaagtatgagaaaaccatcaaatcatttagtctatactaatgctgttttcagtgaatgt
aacagatttggaggaaaaggactgtatatgattagaattagtattaatcatctctcaagt
gttatgacagcacaatggggaattatgtatatggttttttccccatgtggtccaatataa

Exon 10 +      31201      31637   1   Internal    437    77        Good
aaagagcaagtacttcgtcaggagacacattgaatcaaggtgaaacttagttttatctat
atgtaatagttcagtgttaatttcctcaaatgtctaacaagtattaaaacaaatttaaca
aattttacatatgtcaacttattaatttaaaaagaattaatttctcattttccccaatag
ATATTGTTATAAATAAAAAACTTACTAAACAAAAATCATCCTCTTCAATATCTGATCATA
ATTCTGAAGGAACAGGAAAAGTGAAATATAAGAAAGAACAAACCGACCATATCAAAATAG
ATAAAGCAGAAGTAGAAGTTTGCAAGAAACACAATCAGCAACAAAATCATCCTAAATATT
CAGGGCAGAAAAATACTGAAAATGCCAAGCAGAGTGATTGGCCTGTTGAATCTGAAACTA
CTTTTAAATCGGTTCTCCTAAATAAGACAATTGAAGAATCGCTGATATATAGGAAGAAAT
ACATATTGTCAAAAGATGTGAATACTGCTACTTGCGATAAAAATCCATCTGCTAGCAAAA
ATGTGCAAAGTCATAGAAAAGCAGAGAAAGAATTGACTTCTGAGCTTAATTCCTGGGATT
CGAAACAAAAAAAAATG
gtgagctttcaatgtgttttgatttctgcatatccataagatgcctacttgataacataa
gaaagaaagaaacttgattaattgctacacatttaacatgtgtaataccttgtttaattc
agtgcccagactctcagaattcctcactcacctctcccttgtcgtagctctgatagaaca

Exon 11 +      36398      36466   2   Internal     69    51    Marginal
aaatgtccctcaatgatagactggattaagaaaatgtggcacaaatacaccatggaatac
tatgcagtcataaaaaaggatgagttcatgtcctttgtagggacatggatgaagctggaa
accatcattctcagcaaactattgcaaggacaaaaaaacaccgcatgttctcacttgtag
GTGGGAATTGAACGATGAGAACACTTGGACACAGGAAGGGGAACATCACACACTGGGGCC
TGTCGTGGG
gtaggggaaggggggagggatagcattaggagatatacctaatgtaaatgacgagttaat
gggtgcagcacactggcatggcacatgtatacatgtgtaacaaatctgcatgttgtacac
atgtaccctagaacttaaagtataataaaaaaaattatcttattttaatgcctaacaaag

Exon 12 +      36793      36945   0   Terminal    153    81        Good
aaaaaaaattatcttattttaatgcctaacaaagctcaaacttactaaacagttgactct
ctttatttctctccgcaggtataaatagaaccagatttatcttaaaagtttttttcagcc
tttatttttcctttaaagattaactggtagagtttaaaagtaacttacaatttttttcag
AGAGAAAAGTCAAAAGGGAAAGAATTTACCAATGTAGCAGAATCCTTGATAAGCCAAATC
AATAAAAGATACAAAACAAAAGATGACATCAAGTCTACAAGAAAATTAAAGGAGTCTTTG
ATTAACAGGTATGTTCTTAAATTTCAGACATGA
atatttttctgacagatacaactatattacacaattttaaaaaggttaattttaaacata
ggttcagataatgtaacttttcagtagaaaacacatggttacttaatacttttataaata
gtaggtgtttaaattacacaagaagggaactaaatttgaaatttgtcattctattgtcta

Exon 13 +      41462      41532   0   Internal     71    90   Excellent
cagtgtatgaggcccacatcctcactagcatctgttattgcctgtctttttggtacaagc
cattttaactgaggtgagatgacatctcattttttgatttgcatttctgattagtgctgt
tgagcattttttcatatacctgttagccatttaatgatttttttataaccctcttttcag
GAAAAAGTTCAGAAAAAAAGCTACAGAAAACTGAAGACTACCTTTGTTAATGTTACTTCT
GAATGCCCAGT
gtaagtattttttgtaatatttttcattttcttcatatttgaagagactacacatattta
agtggagctaatattgctcttcattttcacaggaatgatgtttacaattttaatttgaat
ggagctgatgaccctatcataaaacttggagtaagctaaaataccaagatactttgtatt

Exon 14 +      41625      41691   2   Terminal     67    77        Good
tataaccctcttttcaggaaaaagttcagaaaaaaagctacagaaaactgaagactacct
ttgttaatgttacttctgaatgcccagtgtaagtattttttgtaatatttttcattttct
tcatatttgaagagactacacatatttaagtggagctaatattgctcttcattttcacag
GAATGATGTTTACAATTTTAATTTGAATGGAGCTGATGACCCTATCATAAAACTTGGAGT
AAGCTAA
aataccaagatactttgtatttactcagaagttacattgcatttaccatgcagttattac
atagaatgtttttaatgtgcatcctcatatgctttaaaatttttaagaaatatataataa
tattttggataaccagcctacgtatatttaggtggctttttttttttttaaatttttgtt

Exon 15 +      42135      42168   0   Internal     34    69    Marginal
aaaaaactattctatttttagtgtattgtattttcttttcaaatacaaatattgtagtaa
agttaattttatgtcaaatcttatgattttgtgaagcaaaactagattttatgtttattc
cttttaatcttttttattttgacactgacacctctttttttttgtttatttacaatatag
ATCCAAGAGTTTCAAGCTACAGCTAAAGAAGCTT
gtgcggataggtcaattagattgtaggtatttttattagattaaaatattctgatctttt
tttttctcttaaatatctcctcccagtcttagagttttttaacaaatgagaagagtgaat
aaaaatgctagtcattattactctcattatgattctgttacttcaacatttactctttaa

Exon 16 +      42609      42661   1   Internal     53    63    Marginal
ccaatatagttattttataactgaggtcagagaggataagtggcttggccagaataatat
agctaattagtgaaaaagttaagactgaaaactcaggtctaattgtccattgtgtattac
cttaagaaaacaagtatgaagggtattttttaattaatacatatttttgtttaagggtag
GTCCAAGGAATCATGATGAACTTAAATCTTCTGTCAAAACAAAAGATAAAAAA
gtaagttataatatctcaatatgtctattagaagtagtatttctcttaatttttaatgtt
aaagattatcaaaaacaagaaaacaaaaacattttgattgttttatttatgcaactatcc
accttcctattatgaattttcttatggtctttcagctatttgtaatcatctaataaaaga

Exon 17 +      43156      43324   0   Internal    169    98   Excellent
gtgactttcttggataggttattaatgccatcctaaattaggatgttaagaaatgacaag
ttagttttcctgttttgggttttgtttttttttgttgttgttgttgttttggtttaactt
accttgcatgacataatgagatgtagtatttcttcatgcatttcaaacttttttttatag
ATTATAACAAATCATCAAAAGAAAAATCTGTTTAGTGATACTGAAACAGAGTACAGATGT
GATGACAGCAAGACTGATATTAGCTGGCTAAGAGAACCGAAATCAAAACCACAGCTAATA
GACTATAGCAGAAATAAAAATGTGAAGAATCATAAAAGTGGAAAATCAA
gtaagaaattatcttttggataaatgttgcaaatgattttgcagtttatttcaattattg
aaaatgctttatataagcttattgtatttagactgttcattactacatactttcatggat
aggacaaaacactagtttttatgttttttgttttattttagtaatacggttatatttatt

Exon 18 +      46099      46242   0    Initial    144    87        Good
agataaaatccattaatttaaagtatgttaatcaagaatcattcttacaaatattttatg
taaaacttgtcacagtgccaattttatagcaaattgcttgtatttcttgtacctcaaata
ttgatctaatattcaggaatttttctcctaaagacacccagtaaaaatatcacaaaaaag
ATGGACAAGACAATTCCGGAAGGAAGAATCAGACTTCCACGAAAAGCAACCAAAACAAAA
AAAAACTATAAAGATCTCTCAAATTCAGAATCAGAGTGTGAACAAGAATTTTCACATTCA
TTTAAAGAGAACATACCAGTAAAG
gtaaatagatacagttcagattaatttctaaaagcctcttaaaatactaaatatatattt
ttgtaaaaaatgtcaaatttatcctgttacttcttaagagttaacttcttttatgacaaa
acttaaataataattctagaaatttgcccttaggcaatataatgctaaattttgtaataa

Exon 19 +      48179      48346   0    Initial    168    59    Marginal
gtatattagaaagtctttcactactcatgtctaggtccttgttatgcctgtatgtggtaa
tatacaacatttaataaatatttgaatataatttgttttatgtgtccaagtgtaaatatt
tgtacttgagtataatttgaaagttattgatacatttaggaggagaatatccattccaga
ATGAAAACGGTAAAGCTACCAAAGAAACAACAGAAAGTCTTCTGTGCTGAAACAGAAAAG
GAACTATCAAAACAATGGAAAAACTCATCTCTACTAAAAGATGCTATACGAGATAATTGC
CTTGACTTATCTCCCAGATCTTTATCTGGCAGTCCATCATCTATAGAA
gtaacgagatgtcagtataactttgttttttctttacttgaatattcaatagttttctat
aactctaattatgggaaaatacaattttaagactaattttgaggggtatttataattata
gtagttaaaacttcattgttaagctaattaatgctagtaacttgacttttgataacatgg

Exon 20 +      55098      55214   1   Internal    117    92   Excellent
ggtagaattgaatgcataattacctaaaacataataaaaatacttagtggaaacaaagcc
tttttaaaataaaagcaagaaaatatgaggtatttttaatgaaaattgcagcgcttttaa
ctttctttaactgttcctaaggccccacccaacatcttagtcgcaaaagaatatatatag
AAGATAATCTAAGTAATTCCAATGAAGTAGAAATGGAAGAGAAAGGAGAAAGGAGAGCAA
ACTTGCTTCCCAAAAAACTGTGTAAAATTGAAGATGCAGATCATCATATCCACAAAA
gtaggtagatcagtagcctgtatcaaaatgcagttatttggagggtggttcttatatttt
gaatgagtctatttacaaaacaaatttgtaaagacaactttggatatgtccaagatggat
gatgctttattgcaaagttcacatttatatgaataattgttgtagtaagggtcttagatg

Exon 21 +      55780      55916   1   Internal    137   100   Excellent
tcagaataatctgatttttaaattaaaaaaaacataaggaactcttctgcctttgatttc
ataatccttaggttacacatagattcggaaaataagatagattttgttcttagcctaatt
acaaggctaaatttagagtaatgcatattttaacttcagcagattgttttcattttttag
TGTCTGAAAGTGTATCTTCATTATCAACAAATGACTTTTCTATTCCTTGGGAGACCTGGC
AAAATGAATTTGCAGGGATAGAGATGACTTATGAGACTTACGAGAGGCTCAATTCAGAAT
TTAAGAGAAGGAATAAT
gtgagttattctttaaattatgatttatacccaataatataataatatgccacactttct
actagaccattggcttgtttgatcctttggcaacaaaatatccattcatgaaaccaactt
tccttatatgtgaataattggaataaaatctgtatattacccgtattctttcttttgcta

Exon 22 +      57235      57338   2   Internal    104    97   Excellent
gagttattttactacgcagtcttggaaaacagctcagcaacatctgagaacaatgaatca
tcaaagtcaggactctaggtctgtaataaaaatctgttctgaaaacttttgaatgctaca
tattcctatattctgaatgctacagtttttaaaattaatctcattttgtttctgtaatag
GATTAAAAAACTTGATAAATTCCAATTCATTATCATAGAGGAGCTGGAGAATTTTGAAAA
AGATTCACAGTCTTTAAAAGATTTGGAAAAGGAATTTGTGGTTT
gttactttaaaaattttttaaataagtttaaaaccttatttttaaagagctatacttgga
aaaactttcttttttgggagcacatcctaaagctttttgttcagaaaataatttagtttt
atcttagatttctaatcagcttcatagaaacacttttgaagtacgaacttaaatttatga

Exon 23 +      57762      57820   1   Internal     59    84        Good
gagcatatgacatctggaatatttttaacatatagccatactgtttatttaaatttgtaa
taatagaaatagagtaattctactgttggattttaatttttaatcatattaaagtttaac
tggattttattttaggactaaaatatttaggactaaataaaattttattaattaatttag
GACTTTTGGGAAAAGATATTTCAGAAGTTCAGTGCATATCAAAAAAGCGAACAACAGAG
gttagtatgacattcttaatggctataatctataaaattagatttttaaattaataaatt
tctatttgaaaaattaaaattatatatactatattatagcactctaatttgaattattga
taaatacaaggttaactcattattttacttcttaggcttcatcttttgaaaacttcattg

Exon 24 +      58183      58239   0   Internal     57    62    Marginal
taaaagtgtcttctgtaatactgatagtgaagaaactgtttttacatccgaggtataaat
tttatgctttttataggttacctctcttgattacaaaaagaatttgttaatgtaactttg
tctttgctgtgaaaactttatggtaaatttcatgggtgaaatatatttacttttttacag
ATGTGTTTGATGAAAGAAGATATGAAAGTGCTGCAAGACAGGCTTCTTAAGGACATG
gtaagtcaactaagtttgaaaatgggataatcatactttaatgtcttttgtttttgattt
ttttgtgtgtgtgcttttatgtctttctttttcttttgggttgagagaaaatagttttag
cccaattacttttagttctttaaataatgggagcatatttatagtgaaagaataggggta

Exon 25 +      59239      59316   0   Terminal     78    78        Good
agtaatgatcacagaattctgtggatatctgtagacctgttagaatgcaatatcttcatg
aaagaagttgttttaaaatgaatcactaataacagcttgatttttttttttctattttat
ttggtggttttacagcgaaaatgtgaaatctaagtgtgattttttttttcttggctatag
CTAGAAGAGGAGCTTCTTAATGTACGCAGAGAACTGATGTCAGTATTCATGTCTCATGAA
AGAAATGCTAATGTGTGA
aatctagtttttatcaccatactttatctaattattattctctgtatataactgaggaaa
taagaatagtcctacaaagagaaaaatatacatgtcaccgaagcaagtgtaccctttata
ggaaccctcaaattaaaaaaaaatgtcttttaatggatgagagggaaccactataacatg

--------------------------------------------------------------------------------