--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (9094 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (7 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1242       1601   0     Single    360    60    Marginal
gtgggaaccgtgtgcctcctggatccaggggacctctgagtgaccgcagggccggggtcc
cctgtcaccccacggccagggcagggagcgctggacaccgggtcccaccggccctgccag
ttcctcttccgggctcgcgggctcccatggccctcgggcccagcgtggtgaccccggggg
ATGGAGCCGTTCCTCAGGAGGCGGCTGGCCTTCCTGTCCTTCTTCTGGGACAAGATCTGG
CCGGCGGGCGGCGAGCCGGACCATGGCACCCCCGGGTCCCTGGACCCCAACACTGACCCA
GTGCCCACGCTCCCCGCCGAGCCTTGCAGCCCCTTCCCTCAGCTCTTCCTTGCGCTCTAT
GACTTCACGGCGCGGTGTGGCGGGGAGCTGAGTGTCCGCCGCGGGGACAGGCTCTGTGCC
CTCGAAGAGGGGGGCGGCTACATCTTCGCACGCAGGCTTTCGGGCCAGCCCAGCGCCGGG
CTCGTGCCCATCACCCACGTGGCCAAGGCTTCTCCTGAGACGCTCTCAGACCAACCGTGA

gtacctcggcctcggagtcagagcctgcctcgcccccagctggggagtccagaacaacgg
caggattttgagttggaaatcgcatgtccgtggctatctgttcattcattcgttcatcca
cgcattcattcagggacagctgatgggccccgggccggcaggtgtggtaggaaaacagca

Exon  2 +       5263       5570   0    Initial    308    95   Excellent
ccacacagctctgaccatctcagggtccccagctaggtctgagccagaccccttagtggg
ttgtggccagcatcctctggggtgggagggtcggggcagctggcagccaaggcaggggtc
tccatctctgaacccttcctagtccgggcccaggccaaggtctgccactaccgggtctcc
ATGGCAGCTGATGGCAGCCTCTACCTGCAGAAGGGACGGCTCTTTCCCGGCCTGGAGGAG
CTGCTCACCTACTACAAGGCCAACTGGAAGCTGATCCAGAACCCCCTGCTGCAGCCCTGC
ATGCCCCAGGTGGGCCTGTGCCTGCCAAGCTGCCCCATGCTGGGCCCGAGGCATGGCCCT
GTTCTAGGTGCTCCTCCCCACCCCGTCACAAAACCCCTGGGGCTGTCAGAGGCGCAGCTC
CAGGGCCCTGCCCAGGCCTGGGAGCATCGGAGCATCCCAGCGGTTCCAGCACATTCTGCT
CTCTGCGG
gtgcctctgagggttgttgggattcctggggtcctagggggctgggagtggggaaaggag
acctgtagcagtgcccagctctgcaggggagcagccaggagggtggggccagtttgggga
aggcactcaaggctgccccaggccccaagggcggaaggtgtgggaggagaggcagatcac

Exon  3 +       6331       6542   2   Internal    212    97   Excellent
cggccacactccgaattcgcccttgggaggaagctgggtgaaggctactttggggaggtg
tgggaaggcctgtggctgggctccctgcccgtggcgatcaaggtcatcaagtcaggtgag
gccccgagatcctgcgccacggccgggccccgcacctgctgtccaaccctcaagccccag
GGCAGTGATGTTCGTGGCGTGGGCCGGTCCTGGAGCCACACCCTCTCTCGCAGCCAACAT
GAAGCTCACTGACCTCGCCAAGGAGATCCAGACACTGAAGGGCCTGCGGCACGAGCGGCT
CATCCGGCTGCACGCAGTGTGCTCGGGCGGGGAGCCTGTGTACATCGTCACGGAACTCAT
GCGCAAGGGGAACCTGCAGGCCTTCCTGGGCA
gtgagtcccctccctgctgccacgtggccctgacgcgcctgcgaccgccccttccctcct
ggcgcagagctgaacctgcggggtttccgaggtgaaccgggcctctctaccgggagcagg
tggccccggctgcagatcccatccctgtctggtctccagccaacagggggctggcgtcag

Exon  4 +       7085       7266   1   Internal    182    95   Excellent
tgagtacaggaccctcgccctgtctcacttggggcttcccgtggccttagccggccatgc
catcctcgccacgtcttagagatgaggaggctgaggcatgggggaaggtgacgtgggtgg
acgctggcctcaccggccgttggccccgtgccctaaaagaccccgcgctgtctcctgcag
CCCCCGAGGGCCGGGCCCTGCGTCTGCCGCCACTCCTGGGCTTTGCCTGCCAGGTGGCTG
AGGGCATGAGCTACCTGGAGGAGCAGCGCGTTGTGCACCGGGACTTGGCCGCCCGGAACG
TGCTCGTGGACGACGGCCTGGCCTGCAAGGTGGCTGACTTCGGCCTGGCCCGGCTGCTCA
AG
gtcagcggaggctctgggcccctgacccagagggggtgggtgaggggaccccggtccacc
tgccctaccaggggccttccctcgcccccaggacgacatctactccccgagcagcagctc
caagatcccggtcaagtggacagcgcctgaggcggccaattatcgtgtcttctcccagaa

Exon  5 +       7358       7514   0   Internal    157    98   Excellent
tgcaccgggacttggccgcccggaacgtgctcgtggacgacggcctggcctgcaaggtgg
ctgacttcggcctggcccggctgctcaaggtcagcggaggctctgggcccctgacccaga
gggggtgggtgaggggaccccggtccacctgccctaccaggggccttccctcgcccccag
GACGACATCTACTCCCCGAGCAGCAGCTCCAAGATCCCGGTCAAGTGGACAGCGCCTGAG
GCGGCCAATTATCGTGTCTTCTCCCAGAAGTCAGACGTCTGGTCCTTCGGCGTCCTGCTG
CACGAGGTTTTCACCTATGGCCAGTGTCCCTATGAAG
gtgggtccccaggcagccagagggaggatgcaggctctgcccaggagtcactggccccgg
gcctggacgctgtcggcaaggggttggagggtctggccaagggcaggcagatgacatggg
gggctacaggaggcctcctccatagggacccccaggcagaatcgaggcagctcttgcccc

Exon  6 +       7706       7887   1   Terminal    182    86        Good
ggcagccagagggaggatgcaggctctgcccaggagtcactggccccgggcctggacgct
gtcggcaaggggttggagggtctggccaagggcaggcagatgacatggggggctacagga
ggcctcctccatagggacccccaggcagaatcgaggcagctcttgccccgcgcctcccag
GGATGACCAACCACGAGACGCTGCAGCAGATCATGCGAGGGTACCGGCTGCCGCGCCCGG
CTGCCTGCCCGGCGGAGGTCTACGTGCTCATGCTGGAGTGCTGGAGGAGCAGCCCCGAGG
AACGGCCCTCCTTCGCCACGCTGCGGGAGAAGCTGCACGCCATCCACAGATGCCACCCCT
GA
gtcctcacgtgacccaacgctctgggctccagccaggccagcccctcctccctgcagagc
gccaactcgaagggatgccggtctgccggaccgaggagcctctggctgtgggcctcaggc
cctggcgtgcacacatgttcgtgcaccaggcagacgtgcagacggagggctggggctgac

Exon  7 +       7945       8066   1   Terminal    122    46    Marginal
gctgcctgcccggcggaggtctacgtgctcatgctggagtgctggaggagcagccccgag
gaacggccctccttcgccacgctgcgggagaagctgcacgccatccacagatgccacccc
tgagtcctcacgtgacccaacgctctgggctccagccaggccagcccctcctccctgcag
AGCGCCAACTCGAAGGGATGCCGGTCTGCCGGACCGAGGAGCCTCTGGCTGTGGGCCTCA
GGCCCTGGCGTGCACACATGTTCGTGCACCAGGCAGACGTGCAGACGGAGGGCTGGGGCT
GA
cgtcccccgtgcagtgtgactcgtgcagacggagggctggggctgacgtcccccatgcag
tgtgactcgtgcagacgaagggctggggctgacgttccccgtgcagtgtgactcgtgcag
acggagggctggggctgacgttccccgtgcagtgtgacacgtgtccctggcctctcaaga

--------------------------------------------------------------------------------