--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (8728 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (4 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       4928       5006   0    Initial     79    47    Marginal
aggttgcgttgagccgagatcgcgtcattgcactccagcctgggcaacaagagcaaaact
ccgtctcaaaaaaaaaaaaagaaagaaagaaagaaagacaggcacagaccccatacagtg
tgtggggtggagggacgtttgaacagagaccccaataagggaactgctggccctggggcg
ATGGCCAAGAGCTTCCCGGACAGCATGCGTGGGGGAAGAAGAGCAGGGGGCGGTGGCGGG
GACGTCTCTGGGCATCCCT
gtgagggtgggagtggggctcccagatggtaacagatttcctaggagtgtaggggagctg
gtggatgttttcacaccttgcagaagcctggccctattcaggcttcaggccctggctgat
gagaggacagcgcttctggatccaaggtggcgtcagctgacccacgggcaagctgggggt

Exon  2 +       6172       6246   2   Internal     75    65    Marginal
aagagccagctccaggggctgccctcctgcagtgggtgcccatgtgtgtcaggtgcctgc
aggggctgccctcctgcagtgggtgcccatgtgtgtcaggtgcctgcccatgtgctgagg
gcctgtgtggccgtggaggcgtgtgtgcccacggcagcgctgcttcctctctgccactag
GAACCAAGAGCGGCGGCGCGCGTGGCAGGCCTCCCGGGAGAGCAAGCTGCAGCCCCTCCC
CAGCTGTGAAGTATG
gtgagtccagccggctggtgtgtgcgtgctgggggggccccagaccgggagactcgggcc
tgacatagcctggcccccgtgcccacagtgccacgccaagtcctgaggaggtgcagagct
gggcgcagtcttttgacaagctgatgcacagcccagcgggacgcagcgtgttccgggcgt

Exon  3 +       6335       6569   2   Internal    235    90   Excellent
ttcctctctgccactaggaaccaagagcggcggcgcgcgtggcaggcctcccgggagagc
aagctgcagcccctccccagctgtgaagtatggtgagtccagccggctggtgtgtgcgtg
ctgggggggccccagaccgggagactcgggcctgacatagcctggcccccgtgcccacag
TGCCACGCCAAGTCCTGAGGAGGTGCAGAGCTGGGCGCAGTCTTTTGACAAGCTGATGCA
CAGCCCAGCGGGACGCAGCGTGTTCCGGGCGTTCCTGCGGACAGAGTACAGCGAGGAGAA
CATGCTCTTCTGGTTGGCCTGCGAGGAGCTGAAGGCCGAGGCCAACCAGCATGTGGTAGA
CGAGAAGGCGAGGCTCATCTACGAGGACTACGTATCCATCCTGTCCCCCAAGGAG
gtgcgccagacaccagaacaggccgggggccgcctgctccaggcactaggtggggaaggc
agctcccgcaccccctgacctcagtgtcttgtcctgcaggtgagcctggactcccgtgtg
cgggagggcatcaacaagaagatgcaggagccgtccgcacacacgttcgacgacgcgcag

Exon  4 +       6669       6860   0   Terminal    192    98   Excellent
gccgaggccaaccagcatgtggtagacgagaaggcgaggctcatctacgaggactacgta
tccatcctgtcccccaaggaggtgcgccagacaccagaacaggccgggggccgcctgctc
caggcactaggtggggaaggcagctcccgcaccccctgacctcagtgtcttgtcctgcag
GTGAGCCTGGACTCCCGTGTGCGGGAGGGCATCAACAAGAAGATGCAGGAGCCGTCCGCA
CACACGTTCGACGACGCGCAGCTGCAGATCTACACGCTCATGCACCGGGACTCCTACCCC
CGCTTCCTCAGCTCTCCCACCTACCGTGCCCTGCTGCTGCAGGGGCCATCACAGTCCTCC
TCCGAGGCCTAG
gccgcccccagcagcacagaccccgccgcctcctacggccgactctgggttcccttcagg
tgttgttgtcggcagggctgtcagggcacatgcctggccggctggggtccccacccgcgg
agacggtcctagacccagtggggagtgctgtgtctcctgggtctgcccacccgtggccaa

--------------------------------------------------------------------------------