--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (56432 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (12 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       4310       4450   0    Initial    141    72        Good
ttccataattggataagggcattacaaacagaagggacagagcaagcaaaagcagggaag
actgaaagtgcagaacttctcagtagaaagggcaaatagctttatgccacaggcagtaca
tctcagagaggagttccacagccactagctttagtgtcatccagaatgtagtcaacatac
ATGCACTCTTCCTCAGACCTTCTCATCCAGAATCTCTGCAGAAGGGGTTCAAGAATCTGG
TTGTCTCAAGGAAACTTTAGGAACACAAAATTTGGAGAGGCACAGGGCCAGCTGACAAAG
GGAGTGATGGACTATAAAGAG
gtaagagtgccctgactgggttggggctaggccaagaattcattccttcattcagtattc
attctgtctttcaataagtatagattgatcccagaaggcactcaggtacatatgtgcaca
aggtagacatgctccctgttcctttgtcacagtctagtggaaagacagtcattaaataag

Exon  2 +       6658       6807   0   Internal    150    92   Excellent
cagttgcgcccgctgttgggactacttccggcttccccgccccgccccgtccccgggcgt
ctccattttggtctcaggtgtggactcggcaagaaccagcgcaagagggaagcagagtta
tagctaccccggccgcggagccggctcactgcactacccccgcccccttctttcctccag
ACGCCGAAGTCGCGGGCGCTCATGGCGGGCCTGGAGGTACTGTTCGCATCGGCAGCGCCG
GCCATCACCTGCAGGCAGGACGCGCTCGTCTGCTTCTTGCATTGGGAAGTGGTGACACAC
GGTTACTTCGGCTTGGGTGTCGGTGACCAG
gtacgccacggagccggccagggtggaggagggaactgtcttctgcccaaactcagagta
ccggaggcctggtccagagcgcccgatttccccgcttctcccagtgcagggtctggggca
gatggcagcgttggtaaaacctgcgggtcggaggttgctcacctgccccatcccagccca

Exon  3 +      10858      10954   0   Internal     97    90   Excellent
atcaattgcactgcagttagagatatcagtttcacctgacttcagggattttctgtaact
ctggaagccaaaggtgatggggtggtgagcagaccaaattgtttatattccaagagagaa
ctctggtggattgaatgctgtacatggaggatataatataaatttaaaggcgtttgccag
AGCAAAGATGAGGATGTCATCAAATTCCTGGCTTCCAAAGTAAACAAATCCACGACACTA
AACACTAAACATATTCGGGAAATTTACCCAGTTTGGG
gtgaggggatagtttctttttcgcagaagaatggtttgattagttttacttttgtttttc
ctcactctcatttctatgcttcaggcctatgaatttcattgtcatccagccaggttttaa
accatgacagttgcgacatcctgaattttatttgggatctctttccccagaggatttctg

Exon  4 +      12265      12370   0   Internal    106    88        Good
ttcttttatggatcttgtttaagaaatcttccccacctagaaatcactatattatttttc
ctgtagaaataatttgagaactatttctcaaactttagtatggaaagtcttaggattttt
aaaaaagaaaagaggaagacatcacaactcacaataaaagatgtattttacacccaccag
GCTGACAAGCATGAAAATGGCAAGCATTTTACCCCTACTAGATTGGCAAGCAATAATAGC
AATGTTGCCAACTACACGGAGCAACAGGAGCTTTCATACATTGCTA
gtgggagtataaatcagtaactctttagaaaacaacttgactttatcttataaattaaaa
gcttttcctccatgcatactgtatagaaatttatccacgtgtaccagatgtgtacaagaa
tgttcatagcagcattgtttataatagcaaaacaaataagctggaaatactccaaatcac

Exon  5 +      12457      12559   1   Internal    103    84        Good
gaaaatggcaagcattttacccctactagattggcaagcaataatagcaatgttgccaac
tacacggagcaacaggagctttcatacattgctagtgggagtataaatcagtaactcttt
agaaaacaacttgactttatcttataaattaaaagcttttcctccatgcatactgtatag
AAATTTATCCACGTGTACCAGATGTGTACAAGAATGTTCATAGCAGCATTGTTTATAATA
GCAAAACAAATAAGCTGGAAATACTCCAAATCACCATCAACAA
gtagatgtataaattgcagcatagtcatacagaatgctgtgtagctgtgaatgtgaatca
gctgtagttaaatgcattgacatggatacatttccaaaaactatcaaataaaaaaggcaa
atgacggaagtgatgctgtgtatttaaaattcaaaaacatttgaagctatatttttatgg

Exon  6 +      13403      13555   0   Internal    153   100   Excellent
cccagagacctgggccctagacctctctctcgctgtaggatcttgggcaagtcatttctc
ttgacctccacatcttcatctgtgaagtgaggtgggtaagattagcttatctcgtgaggt
tctttatagttctgtgttttgagttcatgatctttctcctctcaactgtggtcttcccag
CCGGGTCCCAATGATAAGAAGTCAGAACTGCTGCCAGCTGGGTGGAACAACAATAAAGAC
CTGTATGTCCTCCGGTATGAGTATAAGGATGGGTCCAGAAAGCTCCTTGTGAAAGCCATC
ACCGTGGAGAGCAGCATGATCCTCAATGTGCTG
gtgagtctctgggacacgtgagtctgctgatgagatggggataggaatggctgttttgaa
acccatttaacggtacgaatccagagcttcaatgttcatgtagcccttacctagtgatcc
cacttctggaactttatcttaaggtgagaaccctaagtatagaaaaccttcgtgcacaaa

Exon  7 +      15331      15413   0   Internal     83    92   Excellent
tcctaaatcagagaagtctccaagccttaggaaggtatttcatataaacagtccttatat
atgtctctgtggacatatgtgaatatttctttaggttgaagactttgttactctcccttc
accctcccactcttagccagaaatatcccagtctctcactttctattttcacccatctag
GAATATGGCTCACAGCAAGTGGCAGACTTGACCCTGAACTTGGATGATTATATCGATGCA
GAACACCTGGGTGACTTCCACAG
gtacttctaaatgatgtctcttccctgggaaaaagaagagagaactaatggcaagatatg
aggaatagggtggatgtgtccagaaaattaaggaaggtgaatggaagaaccttttatttc
tgggcacaacttcctaattttcttttctgttttttatgtatttgaagaggagacttccat

Exon  8 +      23026      23211   2   Internal    186   100   Excellent
tggggctgttgcccccctcacccaggtccagcaggcggcctgttcccccacttataaaca
ggccaagcgcaatgccaggagctatcagggccgccgccgccgccgtcgttgcagccagaa
taccacttccagggttcctagccaactgcaagcagttgactcttcatctgcttcctgcag
GACCTACAAGAACAGTGAGGAGCTTCGGTCTCGTATTGTGTCTGGAATCATCACACCTAT
CCATGAGCAGTGGGAAAAGGCTAATGTAAGCAGTCCCCACCGGGAGTTCCCCCCTGCTAC
CGCCAGAGAGGTGGACCCACTCCGGATTCCTCCACACCACCCACACACCAGTCGGCAGCC
TCCCTG
gtgagtacagagtgcctagcgggaagcccatgcttctgtagagggattccagccagctat
ccccatcctgccacttgaccccatccctggcccgtatgtgttttcaacaaaatgatcagt
gtcttggggtgcatggagttagaaagtggagacgtaagtggagcagtgagttcttgaact

Exon  9 +      43228      43542   0   Terminal    315    56    Marginal
gcagtccaaattcagggaaacccaaagtgaggaaatgaacattggcgtggacggagagtg
ttccaggaaaggcctgcacttctggctaaaggagcagggaaaggcactacaaatgctcag
agagagtgggaaaaatctcctgtgtttctttttccttttctccattcatttacatcccag
CCTGCAGCAGTCTGCAGACACCTAAAACTGAGGAAGAACCTTCCTTTCCAACAAGAGGAC
CTGTGGTCTCAAGAGTATGAGACAAACCACTGTTGCTTTTTTCTTCCCTTTGTCCTCCCT
CCACTTGATGTTGGACACAGGCACCGTTGTAGGAACTACATGGCAGAGCAGGTAAAGCCC
CAGCTTTCTGCTCAGAGGACCCAAAAAGGAGCCTTCCAAGGAAATGGAAAGTACTGCGTG
GACCACAGAGCGGGAGGAGCTCAGAAAGCACCCCATAAAGTTGTTATGGCCTTACCTGCA
GCTGTACATAAGTGA
acctgattctaaatagcatatcaaagactttagaatataagtacaggagaactggctctt
caggtcccagactgacaactggatagcacatgcatggtggagaccttagtagcattgtaa
agcctatacaaacagaactgacattgaaagcaaaacttggagcccaaacttaactaggtt

Exon 10 +      48597      48774   2   Internal    178    73        Good
tctcactcactactgctggcctgtgctccatgtcttcccaccgctctgccgcccagctcc
tccaccgatcacaatggaagaagagatcaccatactcgtcattgacaatggctccagcat
gtgcaaagctggttttgctggggacgacgcccctggaaccatgtttccctccactgtcag
GTGCCCCCAACACCAGGGCATGATGGTGGGGATGGGCCAGAAGGTCTTCTACCTGGGCGA
CAAGGCCCAGAGCAAGCACGGCATCCTGACGATGAAGTACCCCATCGAGCACAGGATTTT
CACCAGCTGGGAAGGCATGGAGAAGATCTGGCACCACACCCTACAACAAGCTGCATGT
gttcctggaggagcacctggtgctgctgactgagggccccctgaaccccaaggccaacag
aaagaagatggctcagatcatgtttgagaccttcaataccctggacatgtacgtggcagt
ccaggccatacttctatgcctctgggcgcaccactggcattgtcatggattctggagacg

Exon 11 +      48988      49626   0     Single    639    75        Good
gggccccctgaaccccaaggccaacagaaagaagatggctcagatcatgtttgagacctt
caataccctggacatgtacgtggcagtccaggccatacttctatgcctctgggcgcacca
ctggcattgtcatggattctggagacggagtcacacacacggtgcccatctacaagggct
ATGCCCTCCCCACGCCATCCTGCGTCTGGACCTGGCTGGCCAGGACCTGACCACCTCATG
AAGATTCTCACAGAGTACGACTACAGCTTCCCTACCACAGCCAAGCGGGAGATCATGCGT
GACATCAAGGAGAAGCAGTGCTGCGTCGCCCCGGACTTTGAGCAGGAGATGGCCACCGCT
ATGTCATCCTTCTCCCTGGAGAAAAGCTACAAACTGCCTGACAGCCAGGTGATCACCATT
GGCAACATGCAGTTCCAGTGTTTGGAGGTGTTGTTCCAGCCCTTCTTTCTGGGTGTGGAA
TTTTGCAGCATCCATGAGACCACCTTCAGCTCTATCATAAGGTGTGATGTGGGCATCCAC
AAGGACCTGTATGCCAACACGGTGCTGGCCAGTGGCACCACCATGTACCCAAGCATCTCC
AACAGGATGCAGAAAGAGATCACTGCCCTGGTGCCAGCACAAGGAAGATCAAGATCATCG
TGCTCCCAGAGCGCAAGTACTCCGTGTGGATCAGCAGCTCCATCCTGGCCTCATTGTCCA
CCTTCCAGCAGATGTGGATTAGCAAGCAGGAGTATGACAAGTCGGGCCCCTCCATGTCCA
CCACAAATGCTTCTAAATGGACTACAAGCAGATGTGTAG
catttgctgcataggataattcacacgtataaatttgcccctgacaaatgtatacacctc
atgccagcctcacaaaactggaataagcttttggaaagaaatttgtccttgaagcttgtg
tctgatatcagcagtggattgtagaacttgttgctgattttgaccttgtattcaagttaa

Exon 12 +      49854      49977   1   Internal    124    72        Good
atgtatacacctcatgccagcctcacaaaactggaataagcttttggaaagaaatttgtc
cttgaagcttgtgtctgatatcagcagtggattgtagaacttgttgctgattttgacctt
gtattcaagttaactgttctcttggtatttgtttaatactctacatatctttgatttcag
CCCTTAAGTGCATGTGGTTTGGTCACTTCATGGCTGAGGTGAAGAACATGCTTGTGGAAG
ACAAGTCTATGGCTTGGGGGGTCTGTGTGGCTGGCAGTCTCCCACTGGTGCAGGGTATTC
ATGT
gtcagggctgagtattctgggatttctctagaggctggcaagggctcctgaaccagttgt
catttctgtcttgcctgtaggacccagtttcctttcttagctgatgttttcctgccagaa
caccatgggctgttacttgtcttgagttggaagcggtttgcatttacacctgtaaattta

--------------------------------------------------------------------------------