--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (17699 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (7 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +        185        251   0    Initial     67    45    Marginal
aaccaactggctaggtcatgaggattaaatctgacaactctacctaaccgcctggtgcag
ccaggtgcccacaaaatgggcggccctgccagacttctgaaatagttgtgcctcccacca
caaactgtctgctattgactgagaagagaagcatgttctcttccaaactcaaagaccctt
ATGTTCTGGAAGATCTCTGTAGCAATGAAGAGTGCCACCTTCAAGCTGCTGCTGGTCCAG
GCCAAGG
gtatattgaggtgggtccatccctcacccagagtgtgtgctgaggcatattgcagcccat
attttgaggggtttttcctgctattcattttgtgttgccgccagagaaaactaaactgca
gctcctggctgtcggggaagagctgtgcttctgccagggctagtgtgcctggcaccagct

Exon  2 +       2614       2673   1   Internal     60    91   Excellent
tttctaatttgacaggcatcccagtcgagatccattgcaaagcattgcagaatgtcgatc
ctcttctgttctttctcaccccaggcctcactcccacccctctgtggcaccttccttctc
ttttcccctcctcttctccccccagtcccaccacaccttgcctttgttctatttttgcag
GTCATTTATCTTCAGGCTTTGAGATCTGCGTGGGGGGAGCTGTTGCAGCAGCCCAAGCCG

gtgagttatgctgcctgggggtggtttgcgttcactgacgggatctcaagcccactgctt
tgccccagctgagctagaggtgtgataggtggcaggcaaaccctatgcctctgttggcag
ctgggagggggatgtcacactggttcccaaggctatgtggcggaaggcagcacattttaa

Exon  3 +       7126       7244   0    Initial    119    43    Marginal
tttaacccggagggatctggacaggagcccaactcccccattcataactccaggtgaact
tggatgagcaagttcccctttctcagcctcagtctggccctctgtaaaatggatattaaa
agaaaaacatgcacctctggggctgctgtgaggattggagctaatatgtacaaagcagta
ATGCACAGCCTGGCACCCAGTAGGCTCCTGAGAATCGGTGGCTGTTGCTGGGTTGACAGG
ATCATGGATGAAGGGCATTCAGCCCAGACCAACACCCAGCAGGCCCTCCGTCCACGGCA
gtgagtcatgcagcagcattttttgtttctgcagtgtgccaagctctttatgatctctcc
tttttgccctcttcttttcctatcccctacagctcaagtaagactagactggagtcttca
tactcccctctccaaagcacctactatgtgccaggtgcttcaagcacaagctaggtgctt

Exon  4 +      12173      12301   0    Initial    129    54    Marginal
ctgctttacctccctgggcctctgttttcttgactgtagaatgggaatcagaatgctttg
cagtgctgtgggcaggagttagagatgactttgtgggctcagaacacagtctacagagtg
gtgatcacagatttcattatcttctctttcttcctccccagcaggaattgctgagacagg
ATGGCCTGGCAGGGGCTGGTCCTGGCTGCCTGCCTCCTCATGTTCCCCTCCACCACAGCG
GACTGCCTGTCGCGGTGCTCCTTGTGTGCTGTAAAGACCCAGGATGGTCCCAAACCTATC
AATCCCCTG
gtaggtttcaggcaaggttcttcaatgcccaggtccttggacctgtgcgaggcagcccag
agaggggaggttgcaggcctgggcagctgtgtgctgtcttgtagatccatcccacctgtg
cagggtggtgggtgtcctgccctatagatggcctggacaccaggggctgctgtgtcccca

Exon  5 +      14620      14874   0   Internal    255    95   Excellent
ccctacagtgagctggccaagctctctgggtcattcctgaaggagctggagaaaagcaag
tttctcccaagtatctcaacaaaggagaacactctgagcaagagcctggaggagaagctc
aggggtctctctgacgggtttagggagggagcagagtctgagctgatgagggatgcccag
CTGAACGATGGTGCCATGGAGACTGGCACACTCTATCTCGCTGAGGAGGACCCCAAGGAG
CAGGTCAAACGCTATGGGGGCTTTTTGCGCAAATACCCCAAGAGGAGCTCAGAGGTGGCT
GGGGAGGGGGACGGGGATAGCATGGGCCATGAGGACCTGTACAAACGCTATGGGGGCTTC
TTGCGGCGCATTCGTCCCAAGCTCAAGTGGGACAACCAGAAGCGCTATGGCGGTTTTCTC
CGGCGCCAGTTCAAG
gtggtgactcggtctcaggaagatccgaatgcttactctggagagctttttgatgcataa
gcacctcttttcatggagtagagtcaggagaaacccctgacaccttttcaggttggagtg
cattcattcatcctcttatatgtgccccttccccatgctcagctcagcattgtgtacaaa

Exon  6 +      15841      15978   0    Initial    138    55    Marginal
taccctggacagtgcctaactccttacagaagggagtgaaaacctctttcggaaatgatt
gagagcagcctcttgaatgcttaaatgatcaaggagggagaaaggcaaaccaatttgttc
tgtgcaacaaactcaaaatgtggaccagttccctcagccctcattaaactaattaaactg
ATGGGTATCATGCTTCTACTCCATGGTGAACTGAAGCAGAGTCAAGCTGATGAAGTTAAG
CACAACCATGTTCTTGAGCAGCTGAATTGGCTGCCAAGAGTCCAAGCCATCTGGCCCAAC
ATACGCACTGGGCATTGG
gtaagggactccagaagcagcagctagaaagagaaaaagccctcttcaatccccataatg
cttctttcctcttaatgtctcaaaataaaaccagaaagaggaataaaatgattaagtgct
tgaggccaaatgagttcccttgattcaaataaccctgaatcagaggcagagacctcctga

Exon  7 +      17143      17240   0    Initial     98    71        Good
gagggagtctgcatcccacataattcccatgggctgttttctatgctagatgaccaggac
aggagatagagacatgttcccagacaaggatgagtgagttagggatggaggatgctgtag
ccatgggtggcataatgtcctttactaaaatgacattttgcattaaatgttgttgatgag
ATGTCTTTAAATAGGATGAATGTGAGATTTAATGGCTACAGACCTCATGGGTTCCATTTG
GACACTGGCTTTCTGAATGACTTCATAGAAAATGCAGA
gtgaggaaggtctcatacattctctcattcattcagcaaactcttaattaaaggtctact
gtgtttggcaggccttttgctaggtggtggaagtacagaaaaatgaaatggacaagatct
ctgctgttatggaactaacagtctagtagaggagacaaacacatagacaaaaatataagt

--------------------------------------------------------------------------------