--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (6493 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (5 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1278       1365   0    Initial     88    88        Good
cccaaggaggctgcattgggagccagagggagtcgcctagtatctggtcttgtgggttgg
gggatcgtgccctagttcagctcccttgtcactgccatcttccagtgcctgctgccttgg
gccgccttgaacctccagggtttccagctcctcctccttcaccccagtgccactgccatg
ATGGATGTGAGTGAACTTGGGGAGTCTGCCCGCTACCTCCGCCAGGGCTACCAGGAGATG
ACGAAGGTGCACACTATCCCATGGGACG
gtaagtggagacagagggggaggggtcatagccacagagatgcccttatggactcagacc
aggaattgggaggggtggcaccagctcagggctgaaggggcattggggcctgacagctgg
agccctggacctttcctgcagagtctggggcctggaaattaaaaccccagggacactgta

Exon  2 +       2659       2765   1   Internal    107    98   Excellent
ctcccagctccgcccttcctgagcctgggtttggagggttcttcactggaactcctgggt
cctggcagaggggctttggggagggtcacagctgtatggataccatggcttgggaactcc
agctagaacctggaggtgcctcagcccctctctgagtccagagctctctctgcaacccag
GGAAGAAGCGAGTCTGGGTGCCTGATGAACAGGACGCCTACGTGGAGGCCGAGGTCAAGT
CGGAGGCTACCGGGGGCAGAGTCACCGTGGAGACCAAAGACCAGAAG
gttccgttccccctttcctgagattagcctctctgtccctaggcctcctggccaacagga
tctgccctctggttgaagggggtctgggtatgtgggtgggggtgacaggtgaggtcggtc
ggttcctcccggtcccccggcccctgacacgatctccctggtaggtgctgatggtgcgtg

Exon  3 +       2930       3115   0   Internal    186   100   Excellent
gaccaaagaccagaaggttccgttccccctttcctgagattagcctctctgtccctaggc
ctcctggccaacaggatctgccctctggttgaagggggtctgggtatgtgggtgggggtg
acaggtgaggtcggtcggttcctcccggtcccccggcccctgacacgatctccctggtag
GTGCTGATGGTGCGTGAAGCCGAGCTGCAGCCCATGAACCCGCCTCGCTTCGACTTACTG
GAGGACATGGCCATGATGACGCACCTGAACGAGGCCTCTGTGCTGCACAACCTGCGCCAG
CGCTATGCCCGCTGGATGATCTATGTGAGCCCCAGGCCCGGGCCATGGGCGGGGTGGGGC
TTGTAT
gtggggcggggctagagatgaggtgctgggggcgggcccatagcggtggggcggggctgt
gagcggtggatcggggctgtgaatgatagagcgggtccatagcgggggtggggctgtgag
cgatgaggcggggctctgagcagtgggggcggggctggaggttgggccttgggaccttag

Exon  4 +       3847       4003   0   Internal    157   100   Excellent
aattagccggtcgtggtggcacgcgcttgtagtcctagctaccctgggaggctgaggcag
gacccaggaggcggaggttgcggtgagccgagatcatgccgttgtactccagcctgggag
acagagcaagactccatctcaaaaacaacaacataaaccctacctatactctctcttcag
ACCTACTCAGGCCTCTTCTGTGTCACCATCAACCCCTACAAATGGCTCCCAGTCTATACG
GCCTCCGTAGTGGCTGCTTACAAGGGAAAGCGCCGCTCAGATTCCCCGCCCCATATATAT
GCGGTGGCGGACAACGCCTACAACGACATGCTGCGCA
gtaagggccgcctggactcctccccaaccgcagaccccgacctcggtcccgggaggcctc
tgtaagggacccccttcccccactggcactgccccccttttgacgctgctggacatggtc
gcccagccgttctgtccctccgcatgggagctgacctccactagggacagccccacctgc

Exon  5 +       4302       4333   1   Terminal     32    88        Good
tcgcccagccgttctgtccctccgcatgggagctgacctccactagggacagccccacct
gctccttcccattcctggctctgggtggtggggtctgccccagatggatacccagggtgt
tccacctgtggctggccccacaccttggctgacttctctatccccttccctttcctccag
ACCGAGACAACCAGTCCATGCTGATCACGTGA
gtgtggggctctgggggtggggtggaaaatgctggccatctggcagaaagagggcggtac
cacagtcatttcccaggattgaatccaaagtgcttaggccaggacttttaccacctggag
ctagtgtcccagctgaagctaaattaggcctgagcactttccctgcccccattctgaaca

--------------------------------------------------------------------------------