--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (57085 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (18 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1501       1569   0    Initial     69    89        Good
tgcaagaaaagctgaaaagggaggagcaagatgggatgaaagcatctgggccaaagtgac
ctgaaaacctttagagaagaagctgctggctgagaaggaggtgtgtggctccggtgagac
caccagcttggaggactggtcatcagctgcacgttctgggtctgtcttgggtattcccat
ATGGCCATGAGATCCGGGAGGCACCCCTCGCTGCTGCTGCTTCTAGTGCTGCTGCTGTGG
CTGCTGCAG
gtaagctgagcctgcagcctagtgctcaggtgcagggaactgaaagcaaagcacaagctg
gccctgccccttctaggctaagggaggggagagggactgagtgtgacctgctgggaccca
gggctggctgtcttgagaatggcttaggtagcaggggctctggatttatataaagggaag

Exon  2 +       2207       2316   0   Internal    110    72        Good
accacgctggctaatttctgtattttttatagagatggattttcaccatgttgcccaggc
tggtctcgaactcctaagctcaagtgatttattcgccttgcccttccgaagtgttgggtt
tacaggcatgagccacctcacccagccaacacacacaatttttttttttttttgagacag
GGTCTCGTCATCCAGGCTACAGTGCGTGGTGACATCTCAGTGCACCGCAACCTCCTCCTA
CTGGGTTCAAGCAACCTCCTGGCTCAGCCTCCCGAGTACTGGGACTACAG
gtgcacgccaccatgcccggctagtttttgtatttttattagagacagggtttcaccatg
ttggccaggctggtctcaaactcctgacctcaagtgatctgcctgcctcagcctcccaaa
gtgttaggatgacaggcttgagacactgcgccctgccaagttttataatgatacttctgt

Exon  3 +       5918       6008   0    Initial     91    55    Marginal
ttgtgggagatgccagtggaaatgttgcctagagacttgaataggaaaaagaggagatac
ttacgtagcccttgccatcctgagcactttgtgtgtgagtgttgtatgttaaaaaggaat
aataatagtaccttcatgattgggctgttgtgaggatcaaatacatacaaacacttatac
ATGTACGTATGTGGGGGTTGTGCATGTGTGTGCACAGATGAGGAAATGCAGACTCCAGAG
CATAAATTACCTGCCCGACATCACATAGCTG
gtgaggggtagataaggattttttttttttttttttggcagggtctcactctgctgccca
ggctggagtgcagtggtatgatctcaactcactgcaacctccgcctcccagactcatgcg
atccttccacctcagcctcccaagtagctggaactacaggcatgggccaccatgcctggc

Exon  4 +      11746      11797   2   Internal     52   100   Excellent
gataagtggcaatcatgaattaagatgtagaggataagaaattctatttaccaaaactaa
ctacagaagttctgttttcatcatttctaattctagatttgtgcaactccaggtggtttc
catgtgattctggtaagaatattctctactaattaatattatttttatttttaaggtcag
TATCATTGACAGTGTTCAACAGGAAACAGATGATCTTACTAAGCAAACAAAG
gtgaggtttggaagtcagtttcttaatatataaaatcagtctctacacttgacttagaga
cagaattgcagtttggagttctttagtgccctgccaatgtttggtttgcagaaaataaaa
tagtaacttcatgtggccttttagaatcttgagggactgccagagagttgcaggtgatgc

Exon  5 +      12838      12960   0   Internal    123    98   Excellent
ccccgtggttagagatgactctacagctattaagaagacaggcacttgggttttccaagc
ttaggtggctgttctggcgatgagagaatgcaggccaggtgtcagcacagggcctttaca
tgaagtaagggtgtgataaatcctggctgtgagcatcactgccatcctcattgtcaccag
TGTCACTATAAGTTCCAGGAAAAGATCTACCAGCCTCTACGGCGATCCAAGAGAAGATGG
GTTATCACCACCTTGGAGCTGGAGGAGGAAGACCCGGGACCCTTTCCCAAACTCATTGGT
GAG
gtaaggtgcctactcttaaggaatgaccccatcatgccctctaagtaagcacgccccttt
ggccaggaagattaagtcttgaaaggttatgtgctagtgaggccagggagtgaagtagag
cagaaggagcactggcctggggttcaggaagcctgggttctagaactcactctaactcta

Exon  6 +      14736      14897   0   Internal    162    79        Good
gctaacagttcaacatcattgttcctgcatctcagcccatctgtttatttctttggcaga
tgtgccattgctgggtataatttcttaaagatgccattgattcttagccttgatacttga
ttatcatagtggcttattctcatcctccttttttcttctttccatttttcctccttccag
CTGTTCAATAATATGTCTTATAACATGTCACTAATGTATCTAATCAGTGGACCTGGTGTG
GATGAATATCCAGAGATTGGTTTGTTTTCTCTAGAAGATCATGAGAACGGAAGGATATAT
GTTCACCGCCCTGTCGATCGAGAAATGACACCATCTTTCACG
gtatctaaaacttgatatattctaagctcggatttaaaagctcttgcaagactgttgtat
ttggtaagcattatttaagctgactatgtgccaggttccgggagattgagaaattatgcc
ttgtgacaagctttacgagtatgcctgagacttttgtaatcttcttttagagttgtggac

Exon  7 +      19871      19948   1   Internal     78    53    Marginal
ctttcaaggcccttagaggccccctgggagggccaccgaccctgggcactgagtagccat
agagtgaagtgaggaagaatcggcggaaggtgcagtcttgatccctgactggacttgaat
ctgggctactctacttccaagctgaaggtgaaatagtcacttagtctctccatggtgcag
AGCTGGACAGCAAGGGTGCCTTCCTCCAGGGCTTCCGCGGGGATGAGCAGAGGCCATCTA
CGGGAAGGGCTGGTGCTG
gtgagtccgccctgggcctggctgaagctggcagccaggcttctgcaataaaccttttta
ccccaagcaggatactgtacctggcgaccagttgacccttgagaatccagtggtctgact
gcagaacaggcctctgcctggaccaccctcgtgccaggatccgtgccctttcccactccc

Exon  8 +      25697      25846   0   Internal    150   100   Excellent
ccagtactgttcttgctctctggggtacttggtaaatgagggcagtctgattcctgccct
ccggaactctcagtctagaggaggagacagacgtaacacataattaggataacagttatt
ttattagagtgtcatcgagtaaatggttctgcaggatttttacagctctctgcttcctag
GTTTATTTTGATGTTGTGGAGCGCTCAACAGGAAAAATTGTGGATACATCCTTGATTTTC
AACATTAGGATCAGTGATGTGAATGATCATGCACCCCAGTTTCCAGAGAAGGAATTTAAC
ATCACTGTGCAAGAAAACCAATCTGCAGGT
gtgtgcggctggggggctgccgggcttccttctgtctctgctctgttccttttcattaat
attgatgaggagcttgatcctagtcatcttcagggagagtttttactgttcacatctcaa
agatcgcaggccttggatctgagcgaaatgctttgaggtccgtaagcctcattttgtatc

Exon  9 +      27775      27903   0   Internal    129    92   Excellent
ttattttttttaaatgaaatgtgtggcccatccttgagccccaggcttagattctacatt
tgtagtggggaaccctctgtggctagatttgctattgaaattcctaaacagaatatttct
ttattaatattttcctttcctgtatttgaggggcttaactttccttttcctcccacatag
ACCGCTCCTCAGTTTACACTGCTAATCAGAGCCAGGGACTGTGGAGAACCGTCACTGTCA
TCCACGACCACCGTTCACGTGGATGTGCAAGAAGGCAACAACCACAGGCCTGCATTTACC
CAGGAGAAC
gtgaggctcctgggccgccccaacgtctaagccccaaaacaagtagcccttgggtcctag
gctcagtttttctcagagagggtgttaggctgttatcatattgctgtgaagaaatacctc
agactgggtaatttataaagaaaagaggtttaattggctcatggttctgcaggctttaca

Exon 10 +      30227      30430   0   Terminal    204    50    Marginal
caaatcccttagggcaggtttagcagcatgaggaatatccagggtgttgtgatgaggagc
aacattctttctccttctctctcttgctctctctctgcttctctccctccttcctctctg
ctttccttttcaattgtgtttttgtttccatgacatggacatgatgattgcttctttcag
TATAAGGTTCAGATTCCTGAAGGCCGAGCCAGCCAGGGCGTGTTGCGTCTCCTGGTTCAA
GATCGAGATTCTCCATTTACATCAGCTTGGAGAGCAAAATTCAACATATTGCATGGCAAT
GAAGAGGGGCATTTTGACATTTCGACTGACCCTGAGACCAACGAAGGGATATTAAATGTT
ATCAAGGTAACACCATACCGGTGA
cataccaaccagttagtggcagacgctgaggcctcttctgtaggatcactcacaatgaac
cagggagctaacgtccgtggatgctgggtgctgagcccattacgtaccacacgtcaccag
gcaaggaaggcagggtctcagtgccacttctgtgtgtgggctgaggactcctcctaccaa

Exon 11 +      31813      31937   0   Internal    125    76        Good
agaggagcagcaggtgctaatgaaatcctctctctggggttccagcctttggattatgag
actcgcccagcgcaaagcctcatcattgtcgtggagaatgaggagaggctcgtcttctgt
gagagaggaaagcttcagccgccaaggaaggcagcagccagcgccactgtgagtgtgcag
GTGACAGACGCCAACGACCCACCAGCCTTTCACCCCCAGAGCTTCATTGTCAATAAAGAG
GAGGGCGCCAGGCCTGGGACCCTGTTGGGAACTTTTAATGCCATGGATCCAGACAGCCAG
ATAAG
gtgagaagagagggccaagaagggcggttgtttaagtggaaatagccacataaccaagag
ggctcctgttagaaaaccagctcggccgggcgcggtggctcacgcctgtaatcccagcgc
tttgggaggccgaggcgggtggatcatgaggtcaagagatcgagaccatcctggctaaca

Exon 12 +      35175      35294   1   Internal    120    81        Good
ttaaacactctcgtagtttaattgctcttagaatttctcaaattacttgtggtagaaata
gtgtttctatgacatattttgtttttttatgcaacttttttatcttttaatgtaagtttt
taattttaaaaattgctgtccgttttccttctacaagatatgaactggttcatgacccag
CAAATTGGGTCAGCGTCGACAAAAACTCCGGAGTGGTCATCACCGTGGAGCCAATTGACC
GAGAATCCCCTCATGTAAATAACAGTTTTTATGTAATCATCATTCACGCTGTTGATGATG

gtgagtgtttacccaaaattggaaaaataaaatgctcattcttgcttcctgcgggaaaat
aaccctggtgagcgtctttcagcacagcagagaaaaggataaaataaaccttgttatcac
tctgcatccatgctggtgattatttttggtaataattcttaaaatggtaaacaagggacc

Exon 13 +      37048      37263   1   Internal    216    83        Good
acagatcacgtgcatgccaggagagcttatgacgttgaaagggaaacagttccagtattt
caggaatattttttttctgagagacggagagtgctcattctccagagctgtgtgtgcacg
agataaacaactcctgaaacttcctccccatacaaggcttcccaccgcagactgctacag
GGACCCTAATGCTCTTCCTGTCTGACATCAATGACAACGTCCCGACTCTCCGGCCACGTT
CCCGCTACATGGAGGTCTGTGAGTCTGCTGTGCATGAGCCCCTCCACATCGAGGCAGAGG
ATCCGGACCTGGAGCCGTTCTCTGACCCATTTACATTTGAATTGGACAATACCTGGGGAA
ATGCGGAGGACACATGGAAGTTGGGGAGAAATTGGG
gtgagtttttgtattggttacgggcaaagagtggaaaatgccagatatccaattcaaaca
gatttaggcaaaaaaggactttattagcttaaaaaaccggagaggtctgcgttctggcag
agctggctctaggtgctcaaaggatatccctggatatccttcccacacatggtctgcctt

Exon 14 +      38154      38272   2   Internal    119    60    Marginal
tggggtatcatgtctgacaccagtgtctctttacctggggtgtcttgggctgagccggat
aggggcaatgtgatttacactggggacttctggtcacatagtatcagtctattaccagag
aggctggagactgaggccgcccacctgggaggcccaccaggttgcctgaccaagccccag
GAGGACACTGGAGCCTGAGGCTCAGGTGAACGTCCCTGACTGCAGCATCCCATGTGTGCT
GTCCCTCATCGATGCTGACCTGGCTTCTCGGGAGTGGATGATGAGAAGCTCTGCTACTG
gtgcttttctggactctgccctaggtgcctctttccttgtgtgatttacgtctgtatctt
ttccctgtaaaaaacggcaccatcactgtaacaactttcagtgtgttctgtgagtctttc
tagagaattgttgaacctgagggtggtcttaggaatccgtgaacttgcagttgatgtcag

Exon 15 +      38607      38828   1   Internal    222    62    Marginal
atccgtgaacttgcagttgatgtcagaagtgagggtacccttgaggacccctccctctaa
ctctgcagttggcttactttcatacagagcttggcccgtgcagggcgttcagtaagcgtg
tgttgagcagatgagcagatgagtgagtcaatgcatgccatgttctttttccctttgcag
GTCAATCAGTTGAACTTTTAACCTTGAGAAGCCTGCCACGTGGTAATTACTTGGTGCCAC
TCTTCATTGGAGACAAACAGGGACTTTCCCAGAAGCAAACTGTCCATGTAAGGATCTGCC
CCTGTGCCAGTGGGCTCACATGTGTGGAGCTTGCAGATGCAGAAGTGGGGCTTCATGTGG
GGGCCCTGTTCCCTGTCTGTGCAGCATTTGTGGCTCTGGCAG
gtcagtggtctgtaggggtgtcctgggactgtggctcctctccccaggcaataggccagg
ggtaaggggcttgctggggtaggggacagcggtggcaggattggtggaatggctttgaga
atgacttctgggtgtactcaggctcctagatgtagatcagaggttgccatgctggccagg

Exon 16 +      44117      44199   1   Internal     83    84        Good
ttccctgcctctcttcattttccttttcctcccaccgcgccctccctctcatcgtgttaa
tttgtgtttgcctatgaatatatgagcaaggggaagtggtgagaggtcacgcatgcccac
tttgtttccagctggagagaaatccattctcttttgagtaaatcagcattttccctctag
GATCTCGAGGAAGTGCCTCCATCTGCAGCGAGTCAGTCAGCCCAAGCACGCTGTGCTCTG
GGGAGCTGGGTGAGTTCCAGAAG
gttgctccctgctacggccatctcactagtgactaacagttggtccccctgagagagggc
cgttgtagaagattcggtgatactgtcagaaaaaggcacatagtcaatgaaaatctgaga
agctgggctttttccacccgactctatttccatctatagaactaggtattattattggtg

Exon 17 +      47843      47899   0   Terminal     57    91   Excellent
gccgtgcataactgtatgtatgcatgtgtatatagatagatatgtgtattcagttgaccc
ttgaacaataggagtttgaactgtgtgggtgcacttatatgtgggttttcttctgcctct
gccacccccgagacagcaagaccaacccttcttctccctcctcctcttcattctactcag
AGAGAAGACAATGAAGATGAAGACCTTTATGATAATCCACTTCTACTTAATGAATAG
tgaatatattttccttaatgacattttctttcttctagcttactttgttataatatagta
tataatacatatgacatacaaaatgtgcattaattgactgtttatattattggaaaagct
tccagtcaacagtagactgttagttgagttttcggggaatcaaaagttataggcatgttt

Exon 18 +      55301      55504   0   Terminal    204    98   Excellent
atgtctcccctcagcatggctgccacttctggaactgtacgaactcctgtgtcagctgag
gacacggggcctgagtgctgttactactgcattgatgtgttcctcgaatcaaacctagag
aaatgagctgggtatggaagcacatggcatttaccttctctttcccccacttttccccag
AAACTCCATGTTGCCAATGTGCTGGAAGATGACCCCGGCTACCTACCTCACGTCTACAGC
GAGGAAGGGGAGTGTGGAGGGGCCCCATCCCTCAGCTCTCTGGCCAGCTTGGAACAGGAG
TTGCAACCTGATTTGCTGGACTCTTTGGGTTCAAAAGCGACTCCGTTTGAGGAAATATAT
TCAGAGTCAGGTGTTCCTTCCTAA
aaaaaaaagtctattttggagaattgaaataattcatggaagggaatcactattcaggga
tttttcccctttgctcttcttttccctccttaaaagaaaaattaccttctagtcctagga
tgaggacacactattagtttgaattaaatgctttgatattctcagatcagccatcttgaa

--------------------------------------------------------------------------------