Gene XPO1 Variant 1
DNA : 59.66 KbNT_022184
mRNA : 4139 bp NM_003400
CDS : 3216 bp NP_003391
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  32 bp
tgtgtgtgtgtgtgtgtgtgttgggggaagcgtccctgaaatagtaaatattattgagct
ctttttgcccttttcctgtccgtttttttaatttccttttttgaggtgggaaaactgaaa
cccaccttgattcgtcccctctcccccctccccaccttccctcgccctaatcccccaacg
AGGAAGGAAGGAGCAGTTGGTTCAATCTCTGG
gtaagtcgactgtgtcttcggggccgagggtcgggcggcggcgcggccgggcgggcggga
ggaggccggcgtggggcgcggcggcggcggccgcgggaagcgagcccgggaggcggcggg
cgggccgggggcgcggcgggcccacagcggagcctgcgattgaatggagccgcttttgcc
EXON 2  132 bp
tagctaagtaatttcagcttttgttacttgcttttactatctcagttttctgtaattaaa
gtctctaaagtattcattaaaatatttgtaataacatggttgaagtaaaataacttgtag
gaagtttttgataataccaaaacttgataggcagcttcaattttttttctttattttcag
TAATCTATGCCAGCAATTATGACAATGTTAGCAGACCATGCAGCTCGTCAGCTGCTTGAT
TTCAGCCAAAAACTGGATATCAACTTATTAGATAATGTGGTGAATTGCTTATACCATGGA
GAAGGAGCCCAG
gtaaagtagccaaccaaaactttataacattatgacagtgtaacagagttgttgggttta
gaataaaattttaaattatcacctttaaaaaagatattccatagtttgcattaatttgga
attctgtattaaccataatgaaaattggtttggagaaagaaattgcatgtttgacatggt
EXON 3  102 bp
agtcatatttatataattttatttctatttctgtaaggtctaatttttgagtatttctga
acatcaataatagaatctctgtccaattagaatttgtgccttgctcagtagttttcattt
taatgaatgattcaaaagaatacattagcttaagttttgttttttttaataatattttag
CAAAGAATGGCTCAAGAAGTACTGACACATTTAAAGGAGCATCCTGATGCTTGGACAAGA
GTCGACACAATTTTGGAATTTTCTCAGAATATGAATACGAAA
gtaagcaagtggtggttttaaaatctgttatttcttttcttccagtcataaactttgagg
aaggtatctcatttttagtattagcatttgttatctcaaattattttatattgttaattt
gtttcaaaatttagtcttaagcatataattaattcttgcaaatagtcctaagaattatga
EXON 4  73 bp
tgcatgaaaactcagtatatgggtgaatagatacttgtttaatatgtgtaattaaacttg
gtagcataatgtttttgaaactttagatgtaaatgtgtgaatgtctgtccatttgtgaat
cctgagagttgccagtcctataagcaatatattcacatgcttctattctccaattttcag
TACTATGGACTACAAATTTTGGAAAATGTGATAAAAACAAGGTGGAAGATTCTTCCAAGG
AACCAGTGCGAAG
gtaggaaaataaagaattataaattcagagttttgtttttcctggcatttttattgtagt
tgactgtttgagggggcatgtaatgaatctttagtatattttgctctaatggagcttatt
gcttttatcatgaagcaaacaggtctgtttgtattggtgggtacaggaaggccacttaca
EXON 5  62 bp
agcgtgagccaccgcaccgggccggaatttttttaaaatgccaatactggtgacaggatt
agagtatattaactgattttacttagtctttccattcccacattaattagttctcaaaat
ttatttgcatgctacaaaagagctcaacaatttttttattacgtgcaatttttttaatag
GAATAAAAAAATACGTTGTTGGCCTCATTATCAAGACGTCATCTGACCCAACTTGTGTAG
AG
gtaagagtttattttggagcttattgggagagcataaaatcatttagatattgagtctga
ctacaacctaattctgtcaagacacatagtcacacatatgcacagtcagtcatttacagt
agagctgtaatcatttgttaggattgtctggttatattcttatttatacttacctcaggc
EXON 6  45 bp
agagcataaaatcatttagatattgagtctgactacaacctaattctgtcaagacacata
gtcacacatatgcacagtcagtcatttacagtagagctgtaatcatttgttaggattgtc
tggttatattcttatttatacttacctcaggctctcatttaatcttttacttttccttag
AAAGAAAAGGTGTATATCGGAAAATTAAATATGATCCTTGTTCAG
gtaagctttaacttaactgttttccttagaagaattatgcttattatttgaacaaaatgt
tcgacctacttaggaaataaagtatactaatattttgcagaagtagtgatagtattctta
taataataggtaacctactgtctagtacttgaatgttaatttgctgtggcagtaatcatc
EXON 7  182 bp
gttttgttttctacccagtagggtgaagagggtggcacatttcttcctttaataaaggag
gagaaaatgaaaagtgatttatccttactcctgcctttatccattacataatttctttga
agtttgttttatttgcctttgagaaatgaagtgcgattaacatttcatgtcttgttttag
ATACTGAAACAAGAATGGCCCAAACATTGGCCAACTTTTATCAGTGATATTGTTGGAGCA
AGTAGGACCAGCGAAAGTCTCTGTCAAAATAATATGGTGATTCTTAAACTCTTGAGTGAA
GAAGTATTTGATTTCTCTAGTGGACAGATAACCCAAGTCAAATCTAAGCATTTAAAAGAC
AG
gcaagtaataattatgttttagaattttaaagtgatttctcaaacaatttcaagcagttt
ggatgtaaattgtagatattttaaggaactatgatcagtaatatgttaaattgcttgtag
tggttttcaactgcagattaagaaatagtcctagacggggcctaataatttacctctgaa
EXON 8  49 bp
ttccccttgggttgcccaggctggtctcaaacaatccttctgccatggcctcccaaagtt
ctgcgattacaggcatgagccactgtactgggctttaatcatttttattagtattataga
taactgatacttatttctgtgtcttctaaatctgatatttttgtgtgtttttttttttag
CATGTGCAATGAATTCTCACAGATATTTCAACTGTGTCAGTTTGTAATG
gtaagtgtttttaatttcatttttaaaaacaataataggaaagcaattatttacaagtgt
gttttgttataggaaaattctcaaaatgctccacttgtacatgcaaccttggaaacattg
ctcagatttctgaactggattcccctgggatatatttttgagaccaaattaatcagcaca
EXON 9  120 bp
aactgatacttatttctgtgtcttctaaatctgatatttttgtgtgtttttttttttagc
atgtgcaatgaattctcacagatatttcaactgtgtcagtttgtaatggtaagtgttttt
aatttcatttttaaaaacaataataggaaagcaattatttacaagtgtgttttgttatag
GAAAATTCTCAAAATGCTCCACTTGTACATGCAACCTTGGAAACATTGCTCAGATTTCTG
AACTGGATTCCCCTGGGATATATTTTTGAGACCAAATTAATCAGCACATTGATTTATAAG

gtacagtgaatacatttcagttatttgtcaccggatagccacatatattcttttcacatg
taaagctctcatctctgcattctaaaccttattcaaccttgtttctaacacgaggacgct
gctcaggagaaatttcccatattcacacctagtaaattatttaaagtgagtttcaaatct
EXON 10  129 bp
taggcaataaaattccctctcagtatatctgcatgataaaatatgttcattcacttggcc
tgtttttgacatctacccctatatttaattgttaaagcctttttccttttaattgtgaat
tttaagtaaagtgtgtatcaggccaattaattttatggttccctccccccttttaaatag
TTCCTGAATGTTCCAATGTTTCGAAATGTCTCTCTGAAGTGCCTCACTGAGATTGCTGGT
GTGAGTGTAAGCCAATATGAAGAACAATTTGTAACACTATTTACTCTGACAATGATGCAA
CTAAAGCAG
gtaatataatactatcttgaaaattggctgaataattttagtgccttagaaaataccaaa
ttccaaatgagttattttagaacgacgtatcaaagataagccataatcttttgtttatta
cataaaatttgtagtaagctacaaatttttatgatgtttccaaaaatttcttaaaattca
EXON 11  159 bp
ggaggggctgaggaggactgattgggcctaggaggtggaggctgcagtgagctttggtca
taccactgcactccagcctggacagagtgataccttgtctcaaaaaaataataataaaat
attaagtgtctttagttgttttataaaatgcgaactgatcgtcccttttaaaatttgcag
ATGCTTCCTTTAAATACCAATATTCGACTTGCGTACTCAAATGGAAAAGATGATGAACAG
AACTTCATTCAAAATCTCAGTTTGTTTCTCTGCACCTTTCTTAAGGAACATGATCAACTT
ATAGAAAAAAGATTAAATCTCAGGGAAACTCTTATGGAG
gtaagatatgtggagcttttgctcctaaaattctgctctgcctactaataactcttaaaa
gtgcctttttctaaaatgtatgtaccttttgagatttcttattacttaatatttgatcag
tacattatatatattctcaattctgaattacagttataagcccagttttctgattttatg
EXON 12  198 bp
gggcatgtcagaagaagcagagttactccagagtttgctgtctatttgataagtattgaa
atctgagttgtgatgaataaaacatgaatttttattttcccttaaggtgtaacaagtgaa
aagcaatttgaagttggtaatgtttaagaattattttaacagttttggtcttctgtgtag
GCCCTTCATTATATGTTGTTGGTATCTGAAGTAGAAGAAACTGAAATCTTTAAAATTTGT
CTTGAATACTGGAATCATTTGGCTGCTGAACTCTATAGAGAGAGTCCATTCTCTACATCT
GCCTCTCCGTTGCTTTCTGGAAGTCAACATTTTGATGTTCCTCCCAGGAGACAGCTATAT
TTGCCCATGTTATTCAAG
gtaacagagcggttggttgagtgttcttcctgttgcatactgtggttttgaggtctgaat
ccaaatacttctaatctgtgtaaataaattagctataaaaagagaacccaacaacttctc
catgagtgtggaaaactagaacatgaaaggagttgagtctagaaccttgattctcaagag
EXON 13  139 bp
cctggccacaacagttctttttgcctcggccctccggaatagttggaattataggcatga
atccctacacatggctggcttgtggtttttttggttttgtttgtttttaactaagcttct
acactaatgatttcagtgatctaacgatttttttcttgattgatatattgttgagtatag
GTCCGTTTATTAATGGTTAGTCGAATGGCTAAACCAGAGGAAGTATTGGTTGTAGAGAAT
GATCAAGGAGAAGTTGTGAGAGAATTCATGAAGGATACAGATTCCATAAATTTGTATAAG
AATATGAGGGAAACATTGG
gtaagttaataaatactgttaatctttacctttataaatctattctggggtggaaataca
ttttaggaaatgtacttgtagtttctaaatattttctaaatgtattgttactcatcaata
aaattctgctcattatttgcatttgaaaccatgtttttctttgtagtttatcttactcat
EXON 14  182 bp
gagggaaacattgggtaagttaataaatactgttaatctttacctttataaatctattct
ggggtggaaatacattttaggaaatgtacttgtagtttctaaatattttctaaatgtatt
gttactcatcaataaaattctgctcattatttgcatttgaaaccatgtttttctttgtag
TTTATCTTACTCATCTGGATTATGTAGATACAGAAAGAATAATGACAGAGAAGCTTCACA
ATCAAGTGAATGGTACAGAGTGGTCATGGAAAAATTTGAATACATTGTGTTGGGCAATAG
GCTCCATTAGTGGAGCAATGCATGAAGAGGACGAAAAACGATTTCTTGTTACTGTTATAA
AG
gtatgcaagggataggtatgaattagaattgctaaataagtattatgttgttacaataaa
taatacaaatttgtcttatttacaggatctattaggattatgtgaacagaaaagaggcaa
agataataaagctattattgcatcaaatatcatgtacatagtaggtcaatacccacgttt
EXON 15  157 bp
ggaaaaatttgaatacattgtgttgggcaataggctccattagtggagcaatgcatgaag
aggacgaaaaacgatttcttgttactgttataaaggtatgcaagggataggtatgaatta
gaattgctaaataagtattatgttgttacaataaataatacaaatttgtcttatttacag
GATCTATTAGGATTATGTGAACAGAAAAGAGGCAAAGATAATAAAGCTATTATTGCATCA
AATATCATGTACATAGTAGGTCAATACCCACGTTTTTTGAGAGCTCACTGGAAATTTCTG
AAGACTGTAGTTAACAAGCTGTTCGAATTCATGCATG
gtaaatctctttctttactatattttgcttttatttttattgaagaaaataaatgaatgt
ttttgtcttgttagagacccatgatggagtccaggacaaaataaatgaatatttttgtct
tgttagagacccatgatggagtccaggatatggcttgtgatactttcattaaaatagccc
EXON 16  164 bp
ctcactggaaatttctgaagactgtagttaacaagctgttcgaattcatgcatggtaaat
ctctttctttactatattttgcttttatttttattgaagaaaataaatgaatgtttttgt
cttgttagagacccatgatggagtccaggacaaaataaatgaatatttttgtcttgttag
AGACCCATGATGGAGTCCAGGATATGGCTTGTGATACTTTCATTAAAATAGCCCAAAAAT
GCCGCAGGCATTTCGTTCAGGTTCAGGTTGGAGAAGTGATGCCATTTATTGATGAAATTT
TGAACAACATTAACACTATTATTTGTGATCTTCAGCCTCAACAG
gtatgttaagcactgagcatatgttatttttagaaagtaacacttgtatcaatctgtatg
tatcaatggaaataggagggcaactattggatccaatagaagtgtttctgattaaatttt
ctttcttttttccttgagacagggtcttactctgttgcccaggcttgagtgcagtggcac
EXON 17  135 bp
tctgcaactcctgaccacaagtgattggcctgccttggcttctcaaagtattgggattac
aggagtgatccactgcacctgggccaaaatcagtttcaagacgtttgtgaattgcttgtg
tgtggttttccttattagggtgtataacataaacgttaaaatgtctgctttttaaaatag
GTTCATACGTTTTATGAAGCTGTGGGGTACATGATTGGTGCACAAACAGATCAAACAGTA
CAAGAACACTTGATAGAAAAGTACATGTTACTCCCTAATCAAGTGTGGGATAGTATAATC
CAGCAGGCAACCAAA
gtaagtatttctaccttttcttaaaagttttcatgggatttaacaagacgtgttctttac
aaatgtattgaattcaagccttttaacatgtatgtgtgatccataagtgcttttatgtgt
gtctttctataatttattatctgggcgaggtgtggtggctcacgcctgtaatcctggcac
EXON 18  184 bp
ttttttgtatttttagtagagacggggtttcaccgtgttatccaggatggtcccgatctc
ctgaactcatcatccgcccgcctcggcctctcagagtgctgggattacaggcgtgagcca
ctgttcccagccgtggataattcttatatgataaatggaatttgctttttttcctccaag
AATGTGGATATACTGAAAGATCCTGAAACAGTCAAGCAGCTTGGTAGCATTTTGAAAACA
AATGTGAGAGCCTGCAAAGCTGTTGGACACCCCTTTGTAATTCAGCTTGGAAGAATTTAT
TTAGATATGCTTAATGTATACAAGTGCCTCAGTGAAAATATTTCTGCAGCTATCCAAGCT
AATG
gtaggtgattctgatttcttacacaatgcagtataaacaaaccacttctcttctactgcc
ttaagtcaaacatttgatgttttttacagatttaaatcagacctcccatttcccaaatga
ccctagacatatttaaaacagttaagtgtacctttcccttttaaaattagtcttaaagct
EXON 19  107 bp
aacagttaagtgtacctttcccttttaaaattagtcttaaagcttattttcccaataaat
tttgtgaacttttggctttaaactttttaatggtaaaatggaattgcatctaatgtacac
ctgagtaccactgtataagtttagtggtaaaattagattccatttgattctgttttgtag
GTGAAATGGTTACAAAGCAACCATTGATTAGAAGTATGCGAACTGTAAAAAGGGAAACTT
TAAAGTTAATATCTGGTTGGGTGAGCCGATCCAATGATCCACAGATG
gtaagtgagagatgctttgcttttgatttctagtgttgatgctgtgttttatggaatatg
ctatactctattatgtgcattttgctaatttaaagcatatcaactttgtggttattttat
ggcattttatttattgtagtccttacgttaatatactaatagctgtattccatcttcaaa
EXON 20  195 bp
gatttcctgctttcttttgctaaaaactgttttgacgtaggaaaccctaatacaaacaca
agattttcctgttttcagtagatgatcatgctacatctcatagacaggaataaccttgtt
gtttaaaatagtcaccatgtacctaaattaaaacataacttttttttccctccccaacag
GTCGCTGAAAATTTTGTTCCCCCTCTGTTGGATGCAGTTCTCATTGATTATCAGAGAAAT
GTCCCAGCTGCTAGAGAACCAGAAGTGCTTAGTACTATGGCCATAATTGTCAACAAGTTA
GGGGGACATATAACAGCTGAAATACCTCAAATATTTGATGCTGTTTTTGAATGCACATTG
AATATGATAAATAAG
gtgtgtaatatttcagttatgtaagggggaaattctgcaggatagccttaattcttgaaa
gctaaagtatgtctgtggatataacataattttaatgccatggagtttaaatatttaaac
ttgtatattagggaaatactttcttggttttcaagaacttacttcccaggagtttgaaac
EXON 21  169 bp
ttcattttccgtgagaggtggattgtattttacttgggtttacctttcaggaggcattct
atcttctgtggtttattgaaaactccaaatatttatactggattaagccttgcttttccc
ctcctgtctagcacaacaaagacactgaaacattattttgtttccaccacttatttttag
GACTTTGAAGAATATCCTGAACATAGAACGAACTTTTTCTTACTACTTCAGGCTGTCAAT
TCTCATTGTTTCCCAGCATTCCTTGCTATTCCACCTACACAGTTTAAACTTGTTTTGGAT
TCCATCATTTGGGCTTTCAAACATACTATGAGGAATGTCGCAGATACGG
gtaaataaaagatgttcttttattcatttgcctgccaatccaaaaatacaaatatagtta
attgtacataggaaggtattacttgttcagagttttgagtgtgtgaattacatatatgaa
catctgagaaaatcctataagcagtttaatcaactgttccactccactccaagtgagtcc
EXON 22  135 bp
gcattggatatagttgtattccattattaatttaagaaaccttatgcaagtaattattag
tcatcatcccaaaaaaaagggagaacagggttagattcagaatactttgataagagctaa
atactatcatgagtgctgtcagtctgtagtaactttccattggtattctatgtcttttag
GCTTACAGATACTTTTTACACTCTTACAAAATGTTGCACAAGAAGAAGCTGCAGCTCAGA
GTTTTTATCAAACTTATTTTTGTGATATTCTCCAGCATATCTTTTCTGTTGTGACAGACA
CTTCACATACTGCTG
gtaagaatttaatacgatttaaatgttaagtgccagctgggcacagggcctcacgcctat
aatcccagcactttgggaggtcgaggcggggagattatgaggtcaggagttcgagaacag
cctggccaccatggtgaaactgtctgtactaaaaataccataaaaaaataaaagatacaa
EXON 23  160 bp
gcaggagaatggcttggaccgaggaggcagaggttgcagtgaactaagattgcgccacgg
cattccagcttgggtgacagagcgagactccgtctaaaaaaaaaaaacaaaacaaaaaaa
aacgctaagatctatagttatattacattttggagttaataattttcttcttatcaacag
GTTTAACAATGCATGCATCAATTCTTGCATATATGTTTAATTTGGTTGAAGAAGGAAAAA
TAAGTACATCATTAAATCCTGGAAATCCAGTTAACAACCAAATCTTTCTTCAGGAATATG
TGGCTAATCTCCTTAAGTCGGCCTTCCCTCACCTACAAGA
gtaaatataccttttaataaacgtagaatgttcctggtcgggcacagtggctcacacctg
taatcccagcactttgggaagcctaaggtgggaggattgcttgggcccaaaagttggaga
ccaacctagacaacaaaacaagatcccgtctctacaaaaaaaaaagtagtcagaagtggt
EXON 24  97 bp
ttcttgattaaaaaaaaaaaacattattgggacgctgaggcaggagaatgtcttgaaccc
gggaggcagagattacagtgagcagagatcatgccactgtactccagcctggtgacagag
caatactctgtctcgggggaaaaataaatcattatttaatcattgtgttttgatttgcag
TGCTCAAGTAAAGCTCTTTGTGACAGGGCTTTTCAGCTTAAATCAAGATATTCCTGCTTT
CAAGGAACATTTAAGAGATTTCCTAGTTCAAATAAAG
gtatgtatttatttgctcttgcagaaatattaggggtagatgtgaccacttttatgttac
attgtagaatttttatcacttgatttgtcatgccaaataaatggggtttcaagataatac
gtttacacaatctctgtaatcaaaaaacctgagactggtaatacagtgaaaaactaaagt
EXON 25  1032 bp
aggtttgcagttcattcagctatgtagtatactgtgtcactatcctataatttaaaaccc
agccactttatggataatttatattccttccttctctaaaaaggaaattgctcatctatg
atttctttctttgcaagttgaagtttattgcgttgacatttcaactatctgttttcacag
GAATTTGCAGGTGAAGACACTTCTGATTTGTTTTTGGAAGAGAGAGAAATAGCCCTACGG
CAGGCTGATGAAGAGAAACATAAACGTCAAATGTCTGTCCCTGGCATCTTTAATCCACAT
GAGATTCCAGAAGAAATGTGTGATTAAAATCCAAATTCATGCTGTTTTTTTTCTCTGCAA
CTCGTTAGCAGAGGAAAACAGCATGTGGGTATTTGTCGACCAAAATGATGCCAATTTGTA
AATTAAAATGTCACCTAGTGGCCCTTTTTCTTATGTGTTTTTTTGTATAAGAAATTTTCT
GTGAAATATCCTTCCATTGTTTAAGCTTTTGTTTTGGTCATCTTTATTTAGTTTGCATGA
AGTTGAAAATTAAGGCATTTTTAAAAATTTTACTTCATGCCCATTTTTGTGGCTGGGCTG
GGGGGAGGAGGCAAATTCGATTTGAACATATACTTGTAATTCTAATGCAAAATTATACAA
TTTTTCCTGTAAACAATACCAATTTTTAATTAGGGAGCATTTTCCTTCTAGTCTATTTCA
GCCTAGAAGAAAAGATAATGAGTAAAACAAATTGCGTTGTTTAAAGGATTATAGTGCTGC
ATTGTCTGAAGTTAGCACCTCTTGGACTGAATCGTTTGTCTAGACTACATGTATTACAAA
GTCTCTTTGGCAAGATTGCAGCAAGATCATGTGCATATCATCCCATTGTAAAGCGACTTC
AAAAATATGGGAACACAGTTAGTTATTTTTACACAGTTCTTTTTGTTTTTGTGTGTGTGT
GCTGTCGCTTGTCGACAACAGCTTTTTGTTTTCCTCAATGAGGAGTGTTGCTCATTTGTG
AGCCTTCATTAACTCGAAGTGAAATGGTTAAAAATATTTATCCTGTTAGAATAGGCTGCA
TCTTTTTAACAACTCATTAAAAAACAAAACAACTCTGGCTTTTGAGATGACTTATACTAA
TTTACATTGTTTACCAAGCTGTAGTGCTTTAAGAACACTACTTAAAAAGCAAAATAAACT
TGGTTTACATTT
atttttcctttattgactcatttattcctatattaatgatagtgggtatttgtgtttaag
catcaagtaacattttaaatgaagttggaccccttgatttacaaacaagatttctaaggt
tattgttcctagtaaatgcagcagttgtgtaaaatgaacatgttcctaagataccttttg