Gene TANK Variant 2
DNA : 68.02 KbNT_005403
mRNA : 671 bp NM_133484
CDS : 360 bp NP_597841
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  109 bp
gcttcaaaaggaagtcagagctacagtcacgagtggtttacagaatattttctgatagtc
tttgcttcatttcagtatcgtgccatgattggctgttgctagctacaaataaggaagtct
tcaagttgggggatttctcagtggaagttcccacttcaacataagggagagctctggaca
GTTTGAGCAGCATTGTTAGAGCCTGTGGAAAACACTTTACAACTGTGTAACTGTCTTCAT
CTTTACAGAGGAATAGTCTACAAAGGAAGACTTGTAACCTGGAGAAGAG
gtaatctaatttcaatagttcctactgattcttaacctaggaaaggggcctggatgtctt
aaactgaagtgttgcagatgtgttaccctcttactcttgctatgtgagtaatttatgaca
tgattcaataatgcctttgtagttaacgtcatagttagaaatttggcctttaaaaaatgg
EXON 2  148 bp
aaattgtggaacttaaggtttcatacaatttctagtcaggattttagatgagacttatgt
ttatagtacttggtggtataatgtttgtggtaaaccttatagaactatctttaagatgca
tttttaaaatgaggtttatgtaacttagtaattatctaaattgatctcattattttgcag
ACCTGTCATTTACTCCATCCTTTATAGTGATGCTACAGGACGAAGAGGAATGGATAAAAA
CATTGGCGAGCAACTCAATAAAGCGTATGAAGCCTTCCGGCAGGCATGCATGGATAGAGA
TTCTGCAGTAAAAGAATTACAGCAAAAG
gtgtgtggttctggttttgaaagttattctttatcttggtacatggaattttagagcctt
ttgcatctgaaaaatgttatattgttagaaattgccctgaagaactataattacagaaat
gcaggtatatattaatggattaaatttgaagtttttgtttgttgttttttttaaaaatat
EXON 3  109 bp
aatcactgatgtttgtaacaattacaagtacattcctggagccagtttgtatctcataaa
tcacaatacctgcaaaatgacaatgtgggcaactcatatctatttatattatcaatggat
ggtaaatatatgttcatgtctatcagtgaatatcaggctaactggtttttatgtcagcag
ACTGAGAACTATGAGCAGAGAATACGTGAACAACAGGAACAGCTGTCACTTCAACAGACT
ATTATTGACAAGCTAAAATCTCAGTTACTTCTTGTGAATTCCACTCAAG
gtatgttcatgttaattttttatgtatttctagaacctcttggtgaaaagaaaggtgtaa
gttgagtttttctattttattccttcgttgtttctcaatagttttgatattataactgtg
gtacagttatatgttatgtttatttaaatgaacacttgcaggatatgggaaagtggactt
EXON 4  305 bp
ggaaggaaaaaatataaatggacaacttgtcaaagtaactattacctaaagaattttcta
aaactcctaccttaaaatgtattctctttatggttttgagtttgtattattttttgcttt
ttcaggtggtaccaaaaataagggttttctgctaatgtccaagaggtttttgtcttgcag
ATAACAATTATGGCTGTGTTCCTCTGCTTGAAGACAGTGAAACAAGAAAGAATAATTTGA
CTCTTGATCAGCCACAAGATAAAGTGATTTCAGGAATAGCAAGAGAAAAACTACCAAAGG
TAGACATTGCTTCTGCAGAAAGCAGCATTTAAATGCTGATGCGTGACATAGCTTCCTCAT
TTTATTTTTCTGAAGTGATCTGCTGGAATTCCAAACAGAAGTTCCATATATACAAATATG
TGGCTTAAATATTTCTAAATAGAAGAACTATTTTCAAGTAAAATAAAGGCTGAGGTTTTG
TATTT
cctactgaccgtttttctacatcacaagcatttcaacaaagaaaacatttaacaaagaaa
tagggctggacacactgactcactcctgtaattcaaacactttgggaggccaaggaggga
ggatcacttgagctcagcagtttgagaccagcctgggcaacatagggggatccctatctc