Gene TANK Variant 1
DNA : 99.22 KbNT_005403
mRNA : 2089 bp NM_004180
CDS : 1278 bp NP_004171
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  109 bp
gcttcaaaaggaagtcagagctacagtcacgagtggtttacagaatattttctgatagtc
tttgcttcatttcagtatcgtgccatgattggctgttgctagctacaaataaggaagtct
tcaagttgggggatttctcagtggaagttcccacttcaacataagggagagctctggaca
GTTTGAGCAGCATTGTTAGAGCCTGTGGAAAACACTTTACAACTGTGTAACTGTCTTCAT
CTTTACAGAGGAATAGTCTACAAAGGAAGACTTGTAACCTGGAGAAGAG
gtaatctaatttcaatagttcctactgattcttaacctaggaaaggggcctggatgtctt
aaactgaagtgttgcagatgtgttaccctcttactcttgctatgtgagtaatttatgaca
tgattcaataatgcctttgtagttaacgtcatagttagaaatttggcctttaaaaaatgg
EXON 2  148 bp
aaattgtggaacttaaggtttcatacaatttctagtcaggattttagatgagacttatgt
ttatagtacttggtggtataatgtttgtggtaaaccttatagaactatctttaagatgca
tttttaaaatgaggtttatgtaacttagtaattatctaaattgatctcattattttgcag
ACCTGTCATTTACTCCATCCTTTATAGTGATGCTACAGGACGAAGAGGAATGGATAAAAA
CATTGGCGAGCAACTCAATAAAGCGTATGAAGCCTTCCGGCAGGCATGCATGGATAGAGA
TTCTGCAGTAAAAGAATTACAGCAAAAG
gtgtgtggttctggttttgaaagttattctttatcttggtacatggaattttagagcctt
ttgcatctgaaaaatgttatattgttagaaattgccctgaagaactataattacagaaat
gcaggtatatattaatggattaaatttgaagtttttgtttgttgttttttttaaaaatat
EXON 3  109 bp
aatcactgatgtttgtaacaattacaagtacattcctggagccagtttgtatctcataaa
tcacaatacctgcaaaatgacaatgtgggcaactcatatctatttatattatcaatggat
ggtaaatatatgttcatgtctatcagtgaatatcaggctaactggtttttatgtcagcag
ACTGAGAACTATGAGCAGAGAATACGTGAACAACAGGAACAGCTGTCACTTCAACAGACT
ATTATTGACAAGCTAAAATCTCAGTTACTTCTTGTGAATTCCACTCAAG
gtatgttcatgttaattttttatgtatttctagaacctcttggtgaaaagaaaggtgtaa
gttgagtttttctattttattccttcgttgtttctcaatagttttgatattataactgtg
gtacagttatatgttatgtttatttaaatgaacacttgcaggatatgggaaagtggactt
EXON 4  119 bp
ggaaggaaaaaatataaatggacaacttgtcaaagtaactattacctaaagaattttcta
aaactcctaccttaaaatgtattctctttatggttttgagtttgtattattttttgcttt
ttcaggtggtaccaaaaataagggttttctgctaatgtccaagaggtttttgtcttgcag
ATAACAATTATGGCTGTGTTCCTCTGCTTGAAGACAGTGAAACAAGAAAGAATAATTTGA
CTCTTGATCAGCCACAAGATAAAGTGATTTCAGGAATAGCAAGAGAAAAACTACCAAAG
gtagacattgcttctgcagaaagcagcatttaaatgctgatgcgtgacatagcttcctca
ttttatttttctgaagtgatctgctggaattccaaacagaagttccatatatacaaatat
gtggcttaaatatttctaaatagaagaactattttcaagtaaaataaaggctgaggtttt
EXON 5  77 bp
gatttttctcatttaaagaaaaaaatcaattgtatattacatataggtctataagctgtc
tcaagttatttttcagtagggaaggtaaataaaatttcctttgtgttttctctttactcg
acctcatttgaatttgggagcaatttaaagtagtaatagtaatcattttgtatgtttaag
GTAAGAAGACAAGAGGTTTCTTCTCCTAGAAAAGAAACTTCAGCAAGGAGTCTTGGCAGT
CCTTTGCTCCATGAAAG
gtagttctacatccttttttctcaactcttaaaaattatcaatactgaaatatattttat
atttgttttttttaagctttaacaattgcaaaaaaaatagccttttagaataagtggaag
tgaccaaccccagaatcctacatgttaaagatgacctaaacaagtcatgcagttaatagc
EXON 6  116 bp
tgcctggccctctacaaacacaagctgattttggggacattgtttaggaatttaaaataa
tttttttttacttttaaataattattttgtggcacataaaatggtactacataagtttga
ttatttaaaaaacttggaagttatagctttacattttaaaatgttgatttttttttttag
GGGTAATATAGAGAAGACTTTCTGGGATCTGAAAGAAGAATTTCATAAAATATGCATGCT
AGCAAAAGCACAGAAAGACCACTTAAGCAAACTTAATATACCAGACACTGCAACTG
gtaagatttaatttaatttacagtaatattgatttgcttgattgaaattgatttcctttt
gaatgtgaaaatattcctgaatgcctattaagtgtgtagcatctgtaatttacccctcat
ccacgtatgtttgaatgtgtacatgctgtgtaagttctgtaatgtattacatgtgtaatt
EXON 7  581 bp
cacccgctggagactgctaatattctgtgtaagatggtagcaaattttaaaatcccagtt
gtcttcatttgctataaaaaccaatagaaaaaataataataatctctccaaagctgattg
aacagatttttttaatgatttgaatgcggctgtttctcttttgtgttcttctccctccag
AAACACAGTGCTCTGTGCCTATACAGTGTACGGATAAAACAGATAAACAAGAAGCGCTGT
TTAAGCCTCAGGCTAAAGATGATATAAATAGAGGTGCACCATCCATCACATCTGTCACAC
CAAGAGGACTGTGCAGAGATGAGGAAGACACCTCTTTTGAATCACTTTCTAAATTCAATG
TCAAGTTTCCACCTATGGACAATGACTCAACTTTCTTACATAGCACTCCAGAGAGACCCG
GCATCCTTAGTCCTGCCACGTCTGAGGCAGTGTGCCAAGAGAAATTTAATATGGAGTTCA
GAGACAACCCAGGGAACTTTGTTAAAACAGAAGAAACTTTATTTGAAATTCAGGGAATTG
ACCCCATAGCTTCAGCTATACAAAACCTTAAAACAACTGACAAAACAAAGCCCTCAAATC
TCGTAAACACTTGTATCAGGACAACTCTGGATAGAGCTGCGTGTTTGCCACCTGGAGACC
ATAATGCATTATATGTAAATAGCTTCCCACTTCTGGACCCATCTGATGCACCTTTTCCCT
CACTCGATTCCCCGGGAAAAGCAATCCGAGGACCACAGCAG
gtaactgttttgcattaacaaatatattattatgtgtgaacacacattttgccatacatg
cacagatatgcatctcttttacgttatcaaacatcctttttaaactactgacagccaaag
ttaaggctttcaaaaaaacaagtcccataataaatgacatgaaattagaaaagctgaata
EXON 8  830 bp
ccctttatgaaaccacgaattgagtcatgtcatgctaactttacggaaaagtaatttgct
tttatattagggaattcaatatatatgcccatgcgtaactcattcagaaattcaaatttg
aagtccagtgctatttgaatttaaacataagtaacagatatttttgtttgtttcctgcag
CCCATTTGGAAGCCCTTTCCTAATCAAGACAGTGACTCGGTGGTACTAAGTGGCACAGAC
TCAGAACTGCATATACCTCGAGTATGTGAATTCTGTCAAGCAGTTTTCCCACCATCCATT
ACATCCAGGGGGGATTTCCTTCGGCATCTTAATTCACACTTCAATGGAGAGACTTAAGAC
ACATTTGAAAACAGACATATCAAGTTCTATGTGATGATTTTGGGTTTTTAATACTATAAA
TACTTGATTGTAAACTAAATTCAAGATCATTTATAGGAAAATCTAGTTTCACAGCTATTT
GAATTTTTTTCTGGATTTACTATATAACTCTTATTTTTTAAAAGATCATTCTGTTCTTTC
AAGGAGAAATAAGCCTAAAAGAAGAAAAACAAAAAAAATTCTGTATAAAACTGTAATCCT
TTGTATTCATGTTTACAGTGCTATTACTATAATTCAAAATTATGTATGTGACTTAGAGTT
ATATAATCATAATTTATGTTTATTTCAAATATCTAAGTTTATTGCTTGGATTTCTAGTGA
GAGCTGTTGAATTTGGTGATGTCAAATGTTTCTAGGGTTTTTTTAGTTTGTTTTTATTGA
AAAATTTAATTATTTATGCTATAGGTGATATTCTCTTTGAATAAACCTATAATAGAAAAT
AGCAGACAACATAAACATCTTTGTAAATATCAAACCTAATACATTTCTTGTCCAGTGATA
AAACAACTGGTAGAATTATTTAAACACTTTAGATTTTTAAATAATATACATGGCTTTAAT
TTTTACTGTGTGTATAGCTACATGATGAAATTAATTAAATATTAAGAGGT
acttatgttgtgatcatttgtatgtcctttgttcctgagtaaaaaaaaaaaaaaaaaaag
ggaaggaaggaatcacatttttagggaagtttataaaattcatgttttcatttcagtaac
ctaatagaatggtgatgaccagatttggtggcatttattacaattagtgaatcactttga