Gene SLC4A10 Variant 1
DNA : 359.30 KbNT_005403
mRNA : 3931 bp NM_022058
CDS : 3267 bp NP_071341
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  131 bp
ttatactagtagccaggtgtgggcagtgatacagggcttgggggatctctcttaccggcc
cagggatccaaggcattcagtgcaaaacctggccagcagcccgagtgagtaggagccatg
tgactctggtgagttggagtgtgcaattgcctcctgcttcagagctacctgatccgaata
CTAAGCAGAGCGAGTGCCGGGCTGAGTGTAAGACACTGAAGACACTGCAGAGCAAGGTGC
TTATTCCAGAGGCGTTACAAAACATGGAGATTAAAGACCAGGGAGCCCAAATGGAGCCGC
TGCTGCCTACG
gtaagagacaacctgctatcacatagattaaccgcgtttgctgcaaaacctgttaggcaa
gcggtctgctagctaggtgcagcgagtgtacttttggggtggtggatagctcctacgaca
tatggacaggggtctcctcccatcttgggagactgaaatgcataaagcaaagcacacgat
EXON 2  82 bp
tcaaatttattttactcttctttttaagccaacacttactaatcaaatagactactcatg
aacaactagatttaaatgactgaattaagccttgaaatattaaattatatcaaggtttgt
tttttgaaattgagataatatgtgtgttatcatttaatcttccttatcctcatttaacag
AGAAATGATGAAGAAGCAGTTGTGGATAGAGGTGGAACTCGTTCTATTCTCAAAACACAC
TTTGAGAAAGAAGATTTAGAAG
gtaagaccatttttcttgggatagctattggtgtgctttccaaaagtatttcacagataa
atgtagtttgtcacattgtgaagaattgcaaaagttggtatcagagtaatggtagcttac
tggggaggggtacatctgattgttttggtacagtttggaatgtcaataggcagacctgaa
EXON 3  147 bp
ggtacacttaattaggtaaaatgccaaaagacagtgccacgctccaagctttatgtatca
taaacatcaaaaatgacttgctgaattaaattaaattgagtctccattaacatgtaaatc
atcatatctgtgccctggaataattcagagtttaatttgtgggtttgcttccttatgaag
GTCATCGAACACTATTTATTGGAGTACATGTGCCCTTGGGAGGAAGAAAAAGCCATCGAC
GTCACAGGCATCGTGGTCATAAACACAGAAAGAGAGACAGAGAAAGAGATTCAGGATTAG
AGGATGGAAGGGAGTCACCTTCTTTTG
gtaagaatccttctccttgtttttattaagttaattattgtaatatacttgcttatacaa
ttatgattaggagtaataccttatactcataaaattgtttatacttttataaaagacttt
gggccggttggagagaagtgggagagataaagcttgatctttgtttttctcttatatatt
EXON 4  139 bp
tgatgaatttggttttagttcctgagtttgatttggatgagtgttgcagtggggagcagg
ggaggtgtgagcttggggtggtgcgagcttggggtggtgctgaaggcagtgactgggaca
ttttaagctcagggtcgtggtaatacatgttcatggtaatacatgtctctgattttttag
ACACCCCATCACAGAGGGTACAGTTTATTCTTGGAACCGAGGATGATGACGAGGAACACA
TTCCTCATGACCTTTTCACAGAACTGGATGAGATTTGTTGGCGTGAAGGTGAGGACGCTG
AGTGGCGAGAAACAGCCAG
gtgaggatttttgttaaagggtgaaggtatactaaagaattttcatgttactagaaaaag
agatttctaatgcaacaattttgcaaacatctatgattgctgctgattttagaagttgct
catctagcctgagcatatcctataacgggatatgggtcagaaagaaatctgaaggcagta
EXON 5  161 bp
agttaaatggaattaaaatgaaataagccaaatggcttagactagcttttatatacttcc
aaaacctatgaaccaagacacaatatgactatttttctatttcaaccttttatttttggt
ataaaggatcattaacctacaatataatataaactgtgctgataatatttgtttgtatag
GTGGTTGAAGTTTGAAGAAGATGTGGAAGATGGAGGAGAAAGGTGGAGCAAGCCTTATGT
GGCTACTCTTTCATTGCACAGCTTGTTTGAATTGAGAAGTTGTATTCTGAATGGAACTGT
GTTGCTGGACATGCATGCCAACACTTTAGAAGAAATTGCAG
gtatatcttttcccccttagtgtattttataggtacagctaattttttgttactctcttt
tccttataattcaatatacgtatgaactttggaaaactaattctcataatcactgcataa
ggtcttaaaagtcattttcttttaccctgttatttgagataaaagaagttgaatctcaga
EXON 6  189 bp
ctacaatggaagataaatttccatttataacagcatgcttagagattttttaaagaagtt
atttctatttcaagatgaataatattgtttagggcttgcatatttggactcagtggttca
cggctggcacacgttctagaggaaagctgtgcttatcttcttccggccttttctcttcag
ATATGGTTCTTGACCAACAAGTGAGCTCAGGTCAGCTGAATGAAGATGTACGCCATAGGG
TCCATGAGGCATTGATGAAACAGCATCATCATCAGAATCAGAAAAAACTCACCAACAGGA
TTCCCATTGTTCGTTCCTTTGCTGATATTGGCAAGAAACAGTCAGAACCAAATTCCATGG
ACAAAAATG
gtaaatgtttatttattgtgctctttatgtctactataggtctctgacatatcaaagcgc
ttctaaatcttttaaaacttgttttatttgaaaatgattttttgaaattcagattattgt
agaattcttttcacatgagtatatattcttattatcaagcatcaagttgtaaaaatttta
EXON 7  92 bp
tgttactgataataagaatgtttgtattaatatagatttatttatattgacccttcattc
ttacatcataaatttattaagaaacctgttagtctagtttaattgaagtgcctatttcac
tcagtatgtctacaactatgtaagtaattgtttgtattctgtcacaacaatctcttttag
CAGGTCAGGTTGTTTCTCCTCAGTCTGCTCCAGCCTGTGTTGAAAATAAAAATGATGTTA
GCAGAGAAAACAGCACTGTTGACTTTAGCAAG
gtgagcttttctccctctcatctaagtaagttgctaaattactactagaaattactaccc
attttaagaggtgttgacacaatattttgcatgcgctttttgtttcttgtcaaagcttga
tattgttacagaaaatgttagcattaagtccacatgtaacattttgcctattcaaaaaaa
EXON 8  158 bp
taatccacaagtaaagaaaaaaggttattatagaaaaagggcaaatgagatgtttaactg
tgtgtatttatttaaactatatttattcatggattactatatgtgaagcactgtgcaaga
atatgatttaccagatttttccaattttgatttatcatatttacctggtgatgcttgcag
GTTGATCTGCATTTTATGAAAAAGATTCCTCCAGGTGCTGAAGCATCGAACATCTTAGTG
GGAGAACTGGAGTTCTTGGATCGAACAGTAGTTGCGTTTGTCAGGTTGTCTCCAGCTGTA
TTGCTTCAAGGACTGGCTGAAGTCCCAATCCCAACCAG
gtaaaaagtataaaagcgtcttttgtatttttcttaaaccatcttttcatggaaagaaaa
tgaggattcaatgtaattttctgttagagttttgactagaaactaatgtgaaatccacaa
aactactattaatttttgtttgtggaggaggggaaaagtgctttaaaaattattctcttc
EXON 9  88 bp
taagcataagggtcaatcatggtaaaatttttcaaaataataatgaactatgaaaaacta
tggaagtatttgccatcacaatctccattttcagtaattcctttgagatgagtgattctg
tattactaaaattatttttatatttctaccttaaaacattttttttcttcttaattacag
ATTTTTGTTCATTCTTCTGGGACCCCTGGGAAAGGGTCAACAGTACCATGAGATTGGCAG
ATCAATTGCAACCCTAATGACAGATGAG
gtatttattcaagttctttgggaacattttcccccattaggtatacctaaaacttttgga
ggtcctcttttcatgacagtttgttgtgaatcagatttctctgtattgaatcccattctc
ccatgcttctgctataaaatctcctttagaaaaatgtttcccaaagggataataaattaa
EXON 10  147 bp
ctatatggatccataaaataaattataatattttacaacataaacttctttagagtcaga
gctgtctatttcttcaaattgttataatcacatgtgagataactgagttgaaaacactga
acacattaatattttataattatttttaagctataaataatatttctatttcttctaaag
GTATTTCATGATGTTGCCTATAAAGCTAAAGATCGTAATGACTTGGTATCAGGAATTGAT
GAGTTTCTGGATCAGGTTACTGTTCTCCCTCCTGGAGAATGGGATCCAAGCATTCGAATA
GAGCCTCCCAAAAATGTTCCTTCCCAG
gtatgtatatttgaagacattctttgaaattgaatttttttttgtcttttaaatgcatgt
tttattttattttatttatttatttatttattttattattattatactttaagttttagg
gtacatgtgcacaatgtgccggctagttacatatgtatacatgtgccatgctggtgtgct
EXON 11  101 bp
gaaactaacactttaaaaggctaaataacttcctggaggtcaagcaacaagtaagtacag
agcctgggttctcagctattgtgcatattgcttcaaggaaaaatgaactgttattattat
ttacaattaacacctgaaattaaaacaaaacaaaacacatgaacaaaaaactctccacag
GAGAAGAGGAAGATTCCTGCTGTACCAAATGGAACAGCAGCTCATGGGGAAGCAGAGCCC
CACGGAGGACATAGTGGACCTGAACTCCAGCGAACTGGAAG
gttagtgaaaatcacttctatgggacttcaaggaccaaatgacataccattcttctctgt
cagaaattgctattttgggatctaatttattgtatacttttaatacctgctttttgaggg
tgaaaatgccaattagtttgatttctctgaagttactaatgattgtcattactgttaaac
EXON 12  175 bp
gaacgtagttgtgcagtgcctccctgtagattgttataagacaatgcagcaggttaatgt
gtgtctcacctctgctgatggaaaacgtatactgtgacctggcaacaaagcaaatgagca
ttttgacttgtgtgttttttatatttgggtttcactattgtgttttcccccctgtcttag
GATTTTTGGGGGACTTATTTTAGATATCAAAAGAAAAGCTCCATACTTCTGGAGTGACTT
CAGAGATGCTTTCAGCCTGCAGTGCTTAGCATCTTTTCTATTTCTCTACTGCGCGTGTAT
GTCTCCTGTCATCACGTTTGGAGGACTGCTGGGAGAAGCAACTGAAGGGCGTATA
gtatgtattatgcttttctctgaactttgaaacataatccatttttaagattcatagtta
gataagtgagcatttaattttggattcttttctgaggagagatttgagatatggtctggc
agatacaccttatatgaatttcctggatggctagtggaactggtaatctgggagtggaat
EXON 13  134 bp
gcattttcttcttgctgtcagcccctttagtcatccttctaccccacgtcttgcccaggg
ttgctagacttttcagggtgaagcacaaagcacatatccatgtattttaaatgtcttctc
cttagctacaatggcctcctgtacagcttaggtaattgaaccatttatatctctacacag
AGTGCAATTGAATCTCTCTTTGGAGCATCCATGACCGGGATAGCCTATTCTCTCTTTGGT
GGACAGCCTCTTACCATATTAGGCAGTACAGGACCAGTTTTGGTGTTTGAAAAGATTTTG
TTTAAATTTTGCAA
gtaagtgttatgtactttttggcccttagcctcttccttttttctttactgtatttatac
ttctcccaacatcacttttggaggtctgttgatagagacagaattgcctgatttgtttca
gtttatcatttttgcttcatcatgggaatagaggaaaagtaaaatatttatgtatatttt
EXON 14  246 bp
acaggccatggaccaggggttggggacccctgctttagacagtcttgagtttagatactc
atgggatgtgaagcttatttactttcacttcctgaatgaggtttattttcatttgcttaa
aatgatagcaagctgttaaatgaccttcttttcactgttctttccttttcctcctcccag
AGAATATGGGCTGTCATACCTATCTTTAAGAGCTAGCATTGGACTTTGGACTGCAACTCT
ATGTATCATACTTGTGGCCACAGATGCTAGTTCCCTTGTCTGCTACATCACTCGGTTTAC
TGAAGAAGCTTTTGCTTCCCTGATTTGCATCATTTTCATTTATGAGGCCCTGGAGAAGTT
GTTTGAACTCAGTGAAGCATATCCAATCAACATGCATAATGATCTGGAACTGCTGACACA
ATACTC
gtaagtaccatttcccctgctggccttggggcttttcttttgacaaatattgctattgtt
acaagaaatatgaggaaattactcagcagagaatgtgccttaagttgattcatgacctaa
atcctgactctcagagtcgaacaggattttaaaagttatttaatcggccactcatctgct
EXON 15  106 bp
agtctatccatcttgatttttgaaaatagtctgttgtggagtagtttaggataacctaac
tacttgtctgtcaaatagaggaatgctgtgactggagaaaatggagccgttatacattag
tcttcggtacagtcacaaaaagctacttatttcacaaaagacactattttgccttttcag
GTGTAACTGTGTGGAACCGCATAATCCCAGCAATGGCACATTGAAGGAATGGAGGGAATC
CAATATTTCTGCCTCTGACATAATTTGGGAGAACCTAACTGTGTCA
gtaagtaaaacactgaaaaataagtcatacctaagagcttttgttgacattttgactcaa
ttattgccattacagtaaaatttttttgaatgcataatataaaactaatagttgtgtttt
aattttaatttcatcatttcagatgctcatcagtaaactggggttatctttcattattaa
EXON 16  162 bp
ctcaccacccatccaagttgaacttgaaactcgtaatgtaatgcctgctaaatcattgtg
agagccataaaggaaaagcctcagcatctgaactacaattgatcagaaggtgttagtttt
ctgcaagaaatgtgtccggttttttcttagtagctccatttgttttacttcctctggcag
GAATGCAAATCATTGCATGGAGAGTATGTTGGACGGGCCTGTGGCCATGATCACCCATAT
GTTCCAGATGTTCTATTTTGGTCTGTGATCCTGTTCTTTTCCACAGTTACTCTGTCAGCC
ACCCTGAAGCAGTTCAAGACTAGCAGATATTTTCCAACCAAG
gtacttagactatttcttgatctaaatgtaaaataacataggacaaaagaaagagtaatt
gatgtaataaaaggagccactgaaaggcttttgtgtgagtgagctgccaggttagttgtg
gagtgagatgaggggctgaagagaaagaatttgtgatgcaggtgctgggagtgcatatgc
EXON 17  114 bp
gatacataaatatatattcaggttctgacagagctaatggtaatcttatagtatgcataa
aatataatattatgatattatgtcataaagtgtttataaagtgtgactctagattatgtt
cctgagtattccttgatatttatagctactttaagtgacaagtgttttcattatttttag
GTTCGATCCATAGTGAGTGACTTTGCTGTCTTTCTTACAATTCTGTGTATGGTTTTAATT
GACTATGCCATTGGGATCCCATCTCCAAAACTACAAGTACCAAGTGTTTTCAAG
gtacttactatctctctccctcttcccatctctctcggtctaatcttcatttagatgata
cctataactctagtacttaggattttcatgaaaatatgaagaatttagattagaagacca
gtaaatgaaatgcacacagcatggctaaaatttaggtctaatatttaaaaatataagaat
EXON 18  162 bp
aaaatatttaaagcacttaaaatggttttaagtgatttatgagtattattattatttatt
ataggccactcagctcctctgtttataattagggctttcctagtagcatctgtaagacct
aatttgatcaagtattcattaatccagttcataactatgcacattctttactttatacag
CCCACTAGAGATGATCGTGGCTGGTTTGTTACGCCTTTAGGTCCAAACCCATGGTGGACA
GTAATAGCTGCTATAATTCCAGCTCTGCTTTGTACTATTCTAATTTTTATGGACCAACAG
ATTACAGCTGTCATCATCAACAGGAAAGAGCATAAGCTAAAG
gtatattttaacatccattttaatgtaaataattatgacaactgatatcaactgatgttc
atttgacttctatattctgtattcatttgcacagtgaaatatataaaataatgtttttag
atgtataatttttattgtcttacaagatacttggtcttacaatgagatgagaatttactt
EXON 19  252 bp
cacccaatgagacaaacgagggcaattggaaactgagtgtttgtttaagagttactccag
gagatctgatatgaagggcttgttgagtatcatcaggaagtggtttctattcgcaatcag
gccacccttagccctgttattgacacagtttctttctctctttctttcttttttaaacag
AAAGGTTGTGGGTACCATCTGGACCTATTAATGGTGGCTGTCATGCTCGGTGTATGCTCC
ATCATGGGCCTGCCATGGTTTGTGGCTGCCACAGTCCTCTCCATCACTCATGTCAATAGC
CTAAAACTGGAATCAGAATGCTCAGCTCCAGGAGAACAACCCAAATTTCTCGGCATTCGG
GAGCAAAGGGTTACTGGGCTTATGATTTTTATTCTTATGGGTTCATCAGTCTTTATGACC
AGTATTCTGAAG
gtaacaaaatctgtctttatgaacttgagagaaagaatacatttatcatcatttaaaatt
ttcatttgaatctgagccataaatttgcaaatattgtgtggcatgtgatgaaagtgatga
atttctgaaccatgtttatataattcttcataacctaagggagggaaattacgtcctata
EXON 20  69 bp
ttacctaaggttacacagctaaaaatgctagagctggaacttgaatccttgtcttctgaa
tctgtactatactgtttctattcaaaaatgccttttttccctgtttttttctttgataaa
tgcaaaaccacaatctatttgaaaatgatttctgccttttctccaattgttcttttacag
TTTATTCCCATGCCAGTGCTATATGGAGTGTTTCTTTATATGGGTGCTTCATCTCTAAAG
GGAATTCAG
gtaaattacttacagtactacaggcacatctgtgatgactgaccttaaggtctactgata
agtcatgtgacagctgagaaaatgccaccacctgaggaacagcttttagaccacaattaa
atttcttcaaacttgtcagagttacaaaagttaaagaagattctctccagcatctaaggt
EXON 21  174 bp
aaattgtagtgtttcagagggtaagcataacaatcccattgtcttgatgccgagatatca
acttagtgttatccaggtatgtcatttaacccaaaattgtggaccatattaaacatcaac
ttgtcctacttttattgttgtcttacacctaaaaacaatttagtctgtttaatcttttag
TTCTTTGATAGGATAAAGCTCTTCTGGATGCCGGCAAAACATCAACCAGATTTTATATAC
CTAAGGCACGTACCGCTTCGAAAAGTGCATCTCTTCACAATTATTCAGATGAGTTGCCTT
GGCCTTTTGTGGATAATAAAAGTTTCAAGAGCTGCTATTGTCTTTCCCATGATG
gtatgaaacttctgtcaactatttttctctttctctgatttgctggtctctttggaaaca
taaacacatgaattgaaactggaacaacagagtcattttgaacaattattggaaaatata
agttttggcactgaaagtgtgactaagatagggtttaagaatgcctatgaatttcagtga
EXON 22  123 bp
agtaagaaaagaaaatgaaggaagcagaagactagacaatgttttatacatatatatctt
taatttttactttaatctcaggcctaatagaaattgtttctaccaaaaaccatacaggca
aatctacacctctcgttttaattttttttccactttaaactagtttattatttacttcag
GTGTTAGCCCTGGTATTTGTAAGAAAGTTGATGGACTTGTTGTTCACGAAGCGGGAACTC
AGCTGGTTGGATGATTTGATGCCCGAGAGTAAGAAAAAGAAACTGGAAGATGCTGAAAAA
GAA
gtaagagcaaaatcaatgttttataaagaaagaaaaaaggaacatagtaatatttctttg
caaaactaaattattgtttttatctttagacagttttgtctttagacagtgatcactaac
aaccacaagtagactagtttggaagtttaatgtttaaaatcataaagatttgaacagaga
EXON 23  68 bp
tacttatgttcttggtagctgatactttattgaaaggacctgtgctaacattaataaatg
caaacagagtggaaggtcttgaggttaatgagataatgaaacattaatctgtgtttcttc
tttaatgtaaaatggagactcatcaggttcactttatatactttacatttgtcttttcag
GAAGAACAAAGTATGCTAGCTATGGAAGATGAGGGCACAGTACAACTCCCATTGGAAGGG
CACTATAG
gtaagacataaatttaaaaacacatcaattaaagtaatgaaatgcattgttatatacttt
aagaatttcatactgtgtagatcctcagagaggtttcttgaaattgtataagagtagaaa
gaacgaagagttagataacatgggtcctactgctaagttttgccaataatagccgtgtga
EXON 24  117 bp
tgtacttttaaaaatagttaaggtagtaaattttatgttatgtgtattttaccacaattt
aaaaattgggaaaaatattcttcatagatatatgattgccctatatttagtttctgtcat
tgaaaaactgcagttacttatgtaatgtttattatttcatttggggaaactcctgtctag
AGATGATCCATCTGTGATCAATATATCTGATGAAATGTCAAAGACTGCCTTGTGGAGGAA
CCTTCTGATTACTGCCGATAACTCAAAAGATAAGGAGTCAAGCTTTCCTTCCAAAAG
gtttggattttaaaataatgagaatttatactaattccaattgttttttgacataaacca
taagcaaaagaataatattagtttccatcaaatttagatataaaatattccagaaaattc
tttccaaaagtgggtagaaattgtaattatttcaaatgttggtatgtttttcataccaac
EXON 25  39 bp
agtcttcttagatgctgatctgaagaaagaggaattcctatgttatgctaatatctcttt
ttgttagagagtgattgagggaattgggacagtgtttactataattataaagttccttta
ttttcgtaaccttaaattaactttttctacttaatttttatattacatttttgtcataag
CTCCCCTTCCTAATCACTCTAGAAGCTGATTCCCCAAAG
gtaagaccctctccctcaaatctattccttggttgcatttccttatgttaaatggtgtct
tctagaaacctggtcagtctatgtcctctgtgtgagttttggggaggcaaaaggcatgga
gagtgttgggctcagatccagtagcagactgagtttgatgatatatctgtaacaactcag
EXON 26  555 bp
ctcactgagtgcagaggattttaattgttgctgtctatctgtgcttcgcagcatgagaga
gcaatgcctacgggctcttgtggtgctttggggttgacgggttttatgtctgagcaagca
gatgtcatagtagccatgctggattgcagtaataaatgtgtcctttttttccttctgtag
CATTGAAAGCCGAAAAGAGAAGAAAGCTGACTCAGGGAAAGGTGTTGACAGGGAGACTTG
TCTATGACTCGATCTTCAATTTATTTTTTACATATATATGAGAAGAGTGTCACAATTATT
AATAAAACTGCTTTGATCATGTATTGTAAATTCTGTCCCTCAACCCAAATCCACCTTCAT
ACTGTAAGTAGTGCAATACTTGTTTCATTTCTGTGTTTAAACTTCTGAGCAGTGAGACAT
CCCTGTGAGCAGATACAATAGCCAATGCAAGAATCTGTGTGTTCCTTGCTGTACGTTAGA
CATTTGTAAACTGGATTCTGATTGTCAGTTTTATGAGAGCAATAGCTTCCTTAAAGAGAT
AAGTCATATTTACCTAGTTTGTATTTTCCTACTTTAGTGACCTGAAGATGCCTGATAATT
TCATTCAGAAGAATTTTTGAAAGGTAGTCTTACTTCTTTTTAGTTTTTATAGCTTAGCAT
TAGTGACTTATTTCAAAAGACCCAAATCAAAAAGTTAGTTTGAAAGCATTTTTTAATAAT
TGTATTTATGCATTT
ccttgatttaatatgataaatttaatacttaacaatttatatgtaactaaaacttaaagt
catttgaaaaatatatagaaacctatttacaacttgttaaggacaatcagacataatgca
gagttaagtagtatttgcttaaaattcaagttgtgactaatgatcaaatactaggcttgt