Gene SH3YL1 Variant 1
DNA : 38.19 KbNT_022327
mRNA : 1955 bp NM_015677
CDS : 741 bp NP_056492
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  128 bp
tggggtttcaccatgttagccaggctggtcttgaactcctgacctcaggtgatcccccca
cctcggcctcccaaattgctgggattacaggtgtgagccaccgtgtccggccataaaaca
tttttttacaaaaggcttacaaaggaatatttatagcagttttatttgtaatagccaaaa
GCTGGAAACAACCCAATTGTCTATCAACAGTGACTGGAAGGACAAATTGTGCTATGTCCA
CACATTAGAATACCAGTTGGCAGTCAAAAAGGAAGAGCTGATCTGTGCAGCAATTTGAGT
CTCAGTAA
tttcatggtgagtaaaataagctagacagaaaagaacacacactgatgactatatgaagt
tctggcacagacaaaattcatacttaatgacagaaatcagattggcactaacctgaggca
ggggctgggtataggagtgaccactacagagggcacggatgctgtgatcaggagtggtct
EXON 2  117 bp
atgcctaaccttctgggaatgcagcccagtaggtctcagccttatttcacccagctccta
ttcaaaatggagtccctctggtttgaacacctctgacaattgtatatgagaagaatgaaa
taataataaatttctcacttctatttagcagaatttttcattaaaatatcttttgttatg
TTTCAGTGAATAACCCTATACCTTCCAATTTGAAATCAGAAGCAAAAAAGGCTGCCAAAA
TATTAAGAGAATTCACAGAAATAACTTCCAGAAATGGACCTGATAAGATCATTCCTG
gtaggtaaataggatgagtgctgtttgtctctaaatgtctttttcctaagttgttttttg
cattgttcgacactccatttcaggcagaagcctccatcaatgccaacaagtagttcagcc
accttttgttccaccaccttttttctcatgactgatccagggatgctttggaaactacta
EXON 3  114 bp
tcatgggaatagagaggcctcgtgcccatctgttgagtgactgacttttgttcattgctc
ctgtgtgccccgaattcctagagataacctctgtgtacactgactctgtttaacacttgc
tcgtctatccaggcacatagatcaaaatgcttaccttcccattgttttccacgttaacag
CTCACGTAATTGCGAAGGCTAAAGGCCTTGCAATTCTGTCTGTGATCAAAGCCGGGTTCC
TGGTGACTGCCAGAGGAGGCAGCGGGATTGTAGTGGCGCGCCTTCCAGATGGAA
gtaagttggcgtctgttcactggagtagagagtcttcattctttgttctgtctgttttca
tgtgaacacattgcatagcgagtaggacaggtttcctgcatatcaactaaaacttatgta
ataagggctactcgactgaacgtgcagtttggtgtcagtgaacaagccacaggaaccagc
EXON 4  65 bp
atatttttaactttttaaaaattacatattctttttgaagatcactttaaaatcagggga
aataccaagtctcattattttcaatagaagcactctttagattttagcatttttccttcc
tatatttacatgtcgagggtgttttaatgttaggataacgttcgtttgtttttttattag
AATGGTCTGCACCCTCAGCCATTGGGATAGCTGGCCTTGGTGGAGGATTTGAAATAGGAA
TTGAG
gtaagtagcttgtgcacgtccatacaactgccatatcctctgaagacacctaagatgcaa
cctgtgaaaactgagaggtttcctagcgttcttattgttaccattggcacttaggaaaaa
ttgtttcctttattttctcgatgaatgtctaactaaagctatctgatggttcccatttac
EXON 5  60 bp
agttcaagtgcatgtgatatactgagcaaatgttcttccggggaagaaacttaaggtact
aagggaaagaaggggaaaggtccaagcaaggctgttgcttaaagtttagttaaactcttc
ttcgtccatgttgataggtagttcaggttaccgactcgaggtctgttttttttttaatag
ACACATTTACAGCTACATATTCCCTCTGAGCATTGCCCTGGCTGCCTTCCATAAGTGTGG

gtatgttgtgtcttcattttccttaatctcaaaatattatctaatttctcatgtgatttc
ttctttgagccatttgttatttaagagtgtgttgcttaatgtccacatatttataaattt
cccaaatttatcttgtccttgatttcaaatttcattccattggggtcaaagaaaacattt
EXON 6  74 bp
ttccttctagattgtcagtttttgattcatgtatttgggtctccgatattatgtgcttgt
ataaatatatgtgtattactatgtttataattgttatatctctttggttgattgaccatt
ttatcattataatatgtccctgtttaatcctaattacattttttgttgtttgatataaag
AGTGCCACTCCAGCTTTCTTAGGTTGCCATCTGCATGACACATCTTTCTCCATCCTTTTA
CTGTCAATCTAATG
gtaactttgaatctaaagcgtgtctcctatggagcatataattggatgttgttgttgttg
ttgttattgttgttttatccatgctaataatctctgcctttttatttggttgtttaattc
attcacatttaatagattattgatatcattggatttatatcagccattttacttttttct
EXON 7  113 bp
caatattggcttcataattcatcagctcaaaataaaaatatggctcttgtctcacgttct
ttcctgtctctattgatgttttgctacagtgcatatggtgtagttgagtgttagtcaaga
tgaattttaaatgatatttagtcttaacgatttttaaatccatgggtttctacactttag
GTATCAGACTTGGTGATAATTCTGAATTATGACCGTGCTGTAGAAGCTTTTGCAAAAGGC
GGAAATCTGACCCTCGGAGGGAACTTGACTGTGGCGGTTGGGCCCTTGGGAAG
gtgagttctttaaatagatgttagacagtaaaggtttaacaactgcatattttattttgc
attaataggaaacttgaattaaaatgaacagatttgtacatccccagatttatacatgcc
cgaaagatttgaggtcatcacaaataggaaattcacaaaacacagccagtgagataagct
EXON 8  129 bp
tttttcctctaggccacattaaaacatctaatttaggcctacagtaagtaaaacatagaa
acagctgaagaaggtacagaacaaaataattcatttgagctagaaggagtgctatttaaa
tagtgatcctcggcttggagctgctcacagctttgtgatgcaaaatcttgtgctttgcag
GAACTTGGAAGGAAACGTGGCCCTGAGAAGCTCCGCTGCCGTCTTCACGTACTGCAAGTC
AAGGGGACTCTTTGCAGGCGTGTCTTTAGAAGGGAGCTGTTTGATTGAAAGGAAAGAAAC
TAATAGAAA
gtcagttcaagttaaagtgattttaattgaaagtgtgatgagaaaatagtacttcaaaag
ttgatataatttgcagagtacatttatatattctttttacaacatgtggttttaagtgtg
tatcttacatttaaaaattaaatatacaaataatatatgctcgtagaaaatgcagaagac
EXON 9  169 bp
ggggtacatttaagacttgaacatgggatattgcttaaagttagtgtttaaaaagtagtg
tatatgaagtgctatgtatgaatgattatatatacacaccgtgtgtgcgcacatgctatg
tttaactctagaaaagatttgtgtatattaaaatgtttttaattttatatttcccattag
ATTTTATTGTCAAGATATCCGAGCTTATGACATTTTATTTGGAGATACACCGCGGCCTGC
TCAAGCCGAAGATCTTTATGAAATTCTTGATTCCTTTACTGAAAAGTATGAAAATGAAGG
ACAACGAATCAATGCAAGAAAAGCAGCAAGGGAGCAGAGGAAGTCTTCT
gtaccgtttggttttatgtttcactcagtattctcagaaaatctctttctgtagaacatt
ctgtccctgatatcaggttcctaagaacctactaagcctccttcgtagtttcactgactt
cacattcttgtgaaaaggtcatgctaccttgacatttcctctgtacagatttcagggaaa
EXON 10  79 bp
tcttgtcatccagttcaattacatagagtccagaggggtgcatgtgagctttgagagtgc
cacattaataagcacacatgataaaagtttgctacataacctcattagaaaagagttata
tgtgcctaagtaaaaacaagattttaaaattatgtgtatttatctttttgtttctcccag
GCTAAAGAATTACCTCCAAAGCCATTGTCAAGACCACAGCAGTCATCTGCACCAGTCCAG
CTGAACTCTGGCTCTCAAA
gtaaatatttttgttgcaattcaaatacagttgtaattaagtaattattaaatgttatca
ttaagaaatcaagatacattgttaaactttagagttaaatagaagaactaacatatttaa
gagtaaaataagtgctcagcctcttctaaatacatgagacaaattgtcattgctataatt
EXON 11  60 bp
atgtatcttctggctttattcaggtataccttgtgatttaaagcgcaatcaaatgatgat
gatcctatcaacttagtgatttaaaatatttgctcagcaagggcaggatctggcaatttt
gtgtattttgtatgatatatactaatcagttttcaaaatcaccactctcctcttttttgg
CAGGTAACAGAAATGAATATAAGCTCTATCCTGGACTTTCCAGCTATCATGAGAGAGTTG

gtaaatcagtaaatctatatgttataaatgattcatattcattttgtgatcacaaacttc
ctaattaatctgacaggttatgaaaatctctgggaagtgttcagccctttaatttataga
atattcacattcttttgagaagtacttcatttagaaaatgctatgcttttgttatcttac
EXON 12  847 bp
aatgtgcagagaaaaataagtttaataatgtgatgaaaattacacagactgttgtggttt
ctgccagcctccaagacatcagcatgccaagccctaagtggttaatttttatcttaccag
cagatacccccaatttctcccttaaagaacataaacgtgaatacttttttcttgtttcag
GCAATTTGAATCAACCCATAGAAGTGACAGCGCTGTATTCATTTGAAGGACAGCAGCCTG
GGGATTTGAATTTTCAAGCTGGAGACAGAATCACAGTTATATCAAAAACAGATTCACATT
TTGATTGGTGGGAAGGAAAACTTCGAGGTCAAACTGGCATTTTTCCAGCCAACTACGTAA
CCATGAATTAAAGCGTATACTATTTTCTTCTTTGAGAATTACAAAAAAATTATTTCTACA
CTGACAGGATTTACTAGTTAAGCAATGTTTAATATAAATTTTAAAAAACTTCTGTTCTAC
AAAATTTCCATTCCGTATGTAAAAGATTTTGTTTTTCTATATAAAAAGAGCTGACTGACA
TATCTTTAAATACTTTGTACTAACTTTATCACACTTACTGTGTCATAGAATATCATACAG
TTTATACGCTCATAGTTCTCTTGTGAACACTTCAAACATCGCTAAGCATTTGATCTGGCC
ATGTATATGGTAGCTGTGTTTTAATTTGAGAATCTTGAGGGTAGAGCCACAAATTTCAAT
TCTTACATTTCCATTTGCAAAGTGACTAGAGAAAAAGAAATCAGCTTAAATGAGGTATTA
AGTAATGTTTAGAGTCGTAGGTATTAACTAGAATATAAATCCTTAGAAATTGTCTTTATA
CCTTCAAAAATTATACTATGCATTTATCATAGAAATGTGATTACAAAGAAGTCTGACTAC
CATGTCTTTAAACATATGGCATCTCTCAACTTTTCTTCCTTATGGGGCTACATTTGTTCA
TTTCCAGCAGTAGCATAAACTTACGGTGACATGGTAGACTTGTCTCTAAATAAAATTTTT
AAATGTT
tactaagttaatatttcaattttgtttttcttattttttttgtaaggtaggcagaagtcc
tatgtctcatatgcagggtgaaatccacctccgttctgggctgcctgagctccttcctga
actctagactcccctctccagctatgcactttacagctccgtttggacaaggaacaacac