Gene RRM2 Variant 1
DNA : 7.89 KbNT_005334
mRNA : 2470 bp NM_001034
CDS : 1170 bp NP_001025
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  290 bp
tgtgggggcctgggcggcggcgcccccgacccagccagcggacgggccggggggggaacc
gggaggtcccggggggcgtccacgggggtgtccccgggggtctccggaaggcgccggcgg
aggctcccgcgctgcgcttgaaaatcgcgcgcggccccgcggccagcctgggtaggggca
AGGCGCAGCCAATGGGAAGGGTCGGAGGCATGGCACAGCCAATGGGAAGGGCCGGGGCAC
CAAAGCCAATGGGAAGGGCCGGGAGCGCGCGGCGCGGGAGATTTAAAGGCTGCTGGAGTG
AGGGGTCGCCCGTGCACCCTGTCCCAGCCGTCCTGTCCTGGCTGCTCGCTCTGCTTCGCT
GCGCCTCCACTATGCTCTCCCTCCGTGTCCCGCTCGCGCCCATCACGGACCCGCAGCAGC
TGCAGCTCTCGCCGCTGAAGGGGCTCAGCTTGGTCGACAAGGAGAACACG
gtgagcccgcggggagggcgctgcgggcaggggagggaggcagggaaagcgaagccgctc
ctcactcacacgcgtctccccgcagccgccggccctgagcgggacccgcgtcctggccag
caagaccgcgaggaggatcttccaggagcccacggagccggtgagtggcgggcgtggggc
EXON 2  75 bp
tctccctccgtgtcccgctcgcgcccatcacggacccgcagcagctgcagctctcgccgc
tgaaggggctcagcttggtcgacaaggagaacacggtgagcccgcggggagggcgctgcg
ggcaggggagggaggcagggaaagcgaagccgctcctcactcacacgcgtctccccgcag
CCGCCGGCCCTGAGCGGGACCCGCGTCCTGGCCAGCAAGACCGCGAGGAGGATCTTCCAG
GAGCCCACGGAGCCG
gtgagtggcgggcgtggggcagaggggccagggacggccttgggcgtcttggcgccaaag
ccgcattgtttcctcagctgttcacactcccgccccggctcctttcccgcctaggcggcc
cctccccagggctgcctcccgcgcccctcggcccatttcccggttcgggcgtgcgctcct
EXON 3  144 bp
ggcccatttcccggttcgggcgtgcgctcctctgctgcgacccacggagtgcgacgggac
agccacgttttcacatcgggccccgtgaaattgccgccaatggaaaggacttggtccaga
aaaacgttagtttcatatggttcgcccggtacttaaatgttttattttctcccccaacag
AAAACTAAAGCAGCTGCCCCCGGCGTGGAGGATGAGCCGCTGCTGAGAGAAAACCCCCGC
CGCTTTGTCATCTTCCCCATCGAGTACCATGATATCTGGCAGATGTATAAGAAGGCAGAG
GCTTCCTTTTGGACCGCCGAGGAG
gtaatcggaggaccccagaagacccctgcaggggtgaccgtcacgcctcagacataaatg
cacttggaggttcccgttggcaaggggggctaactgtggggcatagtaagtggtgccagc
atacttaaagtttgagtgctcagtgtgagtcctgtaggctttactctcttccttttatgc
EXON 4  117 bp
ctgcaggggtgaccgtcacgcctcagacataaatgcacttggaggttcccgttggcaagg
ggggctaactgtggggcatagtaagtggtgccagcatacttaaagtttgagtgctcagtg
tgagtcctgtaggctttactctcttccttttatgctaaaattgtgacttccgaacctcag
GTGGACCTCTCCAAGGACATTCAGCACTGGGAATCCCTGAAACCCGAGGAGAGATATTTT
ATATCCCATGTTCTGGCTTTCTTTGCAGCAAGCGATGGCATAGTAAATGAAAACTTG
gtgagtttccaaaacatctttcattcatttgacgttgacgatctgaggtcgaactagttc
gctttcctcgtcttgtatgtttttccatgctgagtgcatctgtgtgtgtaagctgggttt
tatattacatggcatttcctgttttgtaacactttgcagttctttcttatggtattttcc
EXON 5  134 bp
tttcctgatatgtaagttgagcatatgacataaaatatcaaagaattgtgacaaattgga
tgaaatatatatagaaataaaccttataatggtacaaagagtgcgatgctgccagtatcc
gttgacagttgctgctgttggttttttctcaagcttaactttgatgtgttttgccactag
GTGGAGCGATTTAGCCAAGAAGTTCAGATTACAGAAGCCCGCTGTTTCTATGGCTTCCAA
ATTGCCATGGAAAACATACATTCTGAAATGTATAGTCTTCTTATTGACACTTACATAAAA
GATCCCAAAGAAAG
gtgagtattcaagtggtatgccaagatttttaggactcactaattgttgatttattacac
atttttagttcacctagggataaaaatgactccagaatgactaagacagtcataggcatt
cccagcacccgtggtcatgtctgctcttagcaaggggcctaaatgcactttattattcac
EXON 6  95 bp
aacactggagggaaaaactgaccagtaaaaataaaacatttcggtgtgagttcttccttt
aggaagaggattggcaaatacttgaatttggcctttgtcccagagctcttatctagcagt
tggtaatcggaggtcttttactgtaatgcttcaattgctgataccgtatgtgcctactag
GGAATTTCTCTTCAATGCCATTGAAACGATGCCTTGTGTCAAGAAGAAGGCAGACTGGGC
CTTGCGCTGGATTGGGGACAAAGAGGCTACCTATG
gtaaggagacccttgcccctacttaaacctgagcttcattttccaagtaatgttactgga
tttttggcccttgaataccaactcactagaatcatgttggtgttaactcctaaataggtg
aacgtgttgtagcctttgctgcagtggaaggcattttcttttccggttcttttgcgtcga
EXON 7  134 bp
cttgtgtcaagaagaaggcagactgggccttgcgctggattggggacaaagaggctacct
atggtaaggagacccttgcccctacttaaacctgagcttcattttccaagtaatgttact
ggatttttggcccttgaataccaactcactagaatcatgttggtgttaactcctaaatag
GTGAACGTGTTGTAGCCTTTGCTGCAGTGGAAGGCATTTTCTTTTCCGGTTCTTTTGCGT
CGATATTCTGGCTCAAGAAACGAGGACTGATGCCTGGCCTCACATTTTCTAATGAACTTA
TTAGCAGAGATGAG
gtgagtctaagtcaaataatagggtgacctaaaccccaaacacaactcgggcatgctctt
gtgttcactgacggggacctgagatgctagatggcatatatccacatttaatgtgtgagt
tcaaccatacacatacttgacaaaagaaggaaatactttcatttactgaaactgttttac
EXON 8  105 bp
ggtagtgacatcagcagagaagtcagtagttgaagtcatcttccctttgagagttcaagt
gctctcagtatggctgagcatgttggataaggagaatgcagaaaaggacaaagtaatttc
atattccatgttaatgacagaagtcttctggctttagtgatcttgaacttttttttctag
GGTTTACACTGTGATTTTGCTTGCCTGATGTTCAAACACCTGGTACACAAACCATCGGAG
GAGAGAGTAAGAGAAATAATTATCAATGCTGTTCGGATAGAACAG
gtaaagtgggtgatgaaatgggtcactcaagcttgctagaaaatgcctgtgctttagttg
tattcagaagctgtattttggttcctaggagttcctcactgaggccttgcctgtgaagct
cattgggatgaattgcactctaatgaagcaatacattgagtttgtggcagacagacttat
EXON 9  114 bp
attttgcttgcctgatgttcaaacacctggtacacaaaccatcggaggagagagtaagag
aaataattatcaatgctgttcggatagaacaggtaaagtgggtgatgaaatgggtcactc
aagcttgctagaaaatgcctgtgctttagttgtattcagaagctgtattttggttcctag
GAGTTCCTCACTGAGGCCTTGCCTGTGAAGCTCATTGGGATGAATTGCACTCTAATGAAG
CAATACATTGAGTTTGTGGCAGACAGACTTATGCTGGAACTGGGTTTTAGCAAG
gtaaagtattgtttacatagccttttgcttgttttgaagctggtgctctgtatttatatc
ttgatgtgaaccttttcaggttttcagagtagagaacccatttgactttatggagaatat
ttcactggaaggaaagactaacttctttgagaagagagtaggcgagtatcagaggatggg
EXON 10  1262 bp
aggccttgcctgtgaagctcattgggatgaattgcactctaatgaagcaatacattgagt
ttgtggcagacagacttatgctggaactgggttttagcaaggtaaagtattgtttacata
gccttttgcttgttttgaagctggtgctctgtatttatatcttgatgtgaaccttttcag
GTTTTCAGAGTAGAGAACCCATTTGACTTTATGGAGAATATTTCACTGGAAGGAAAGACT
AACTTCTTTGAGAAGAGAGTAGGCGAGTATCAGAGGATGGGAGTGATGTCAAGTCCAACA
GAGAATTCTTTTACCTTGGATGCTGACTTCTAAATGAACTGAAGATGTGCCCTTACTTGG
CTGATTTTTTTTTTCCATCTCATAAGAAAAATCAGCTGAAGTGTTACCAACTAGCCACAC
CATGAATTGTCCGTAATGTTCATTAACAGCATCTTTAAAACTGTGTAGCTACCTCACAAC
CAGTCCTGTCTGTTTATAGTGCTGGTAGTATCACCTTTTGCCAGAAGGCCTGGCTGGCTG
TGACTTACCATAGCAGTGACAATGGCAGTCTTGGCTTTAAAGTGAGGGGTGACCCTTTAG
TGAGCTTAGCACAGCGGGATTAAACAGTCCTTTAACCAGCACAGCCAGTTAAAAGATGCA
GCCTCACTGCTTCAACGCAGATTTTAATGTTTACTTAAATATAAACCTGGCACTTTACAA
ACAAATAAACATTGTTTGTACTCACAAGGCGATAATAGCTTGATTTATTTGGTTTCTACA
CCAAATACATTCTCCTGACCACTAATGGGAGCCAATTCACAATTCACTAAGTGACTAAAG
TAAGTTAAACTTGTGTAGACTAAGCATGTAATTTTTAAGTTTTATTTTAATGAATTAAAA
TATTTGTTAACCAACTTTAAAGTCAGTCCTGTGTATACCTAGATATTAGTCAGTTGGTGC
CAGATAGAAGACAGGTTGTGTTTTTATCCTGTGGCTTGTGTAGTGTCCTGGGATTCTCTG
CCCCCTCTGAGTAGAGTGTTGTGGGATAAAGGAATCTCTCAGGGCAAGGAGCTTCTTAAG
TTAAATCACTAGAAATTTAGGGGTGATCTGGGCCTTCATATGTGTGAGAAGCCGTTTCAT
TTTATTTCTCACTGTATTTTCCTCAACGTCTGGTTGATGAGAAAAAATTCTTGAAGAGTT
TTCATATGTGGGAGCTAAGGTAGTATTGTAAAATTTCAAGTCATCCTTAAACAAAATGAT
CCACCTAAGATCTTGCCCCTGTTAAGTGGTGAAATCAACTAGAGGTGGTTCCTACAAGTT
GTTCATTCTAGTTTTGTTTGGTGTAAGTAGGTTGTGTGAGTTAATTCATTTATATTTACT
ATGTCTGTTAAATCAGAAATTTTTTATTATCTATGTTCTTCTAGATTTTACCTGTAGTTC
AT
acttcagtcacccagtgtcttattctggcattgtctaaatctgagcattgtctaggggga
tcttaaactttagtaggaaaccatgagctgttaatacagtttccattcaaatattaattt
cagaatgaaacataatttttttttttttttttgagatggagtctcgctctgttgcccagg