Gene REL Variant 1
DNA : 41.17 KbNT_022184
mRNA : 2336 bp NM_002908
CDS : 1860 bp NP_002899
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  186 bp
gcctccgggtgagggttgctgcgtcgggcctacgtcagccgcgggaaattcccctcccgc
caggctgctcgcctctcggctgggccagcactcggctctccccgctccgccccctgcccc
tggctcccgtacggtggacggcgacgctgggtgacccggggtgcaagaattcaggggttg
GGAAGGTGTGAGCCGCAAACCCAGCGGAGGGCGGGAAGAAGGAGGAGGCCTCTAGGGTGG
TCGGGGGACTGGGGGCCCCGCCGGCAGAGGTCCCTCGGCCTCCTGACTGACTGACTGCGG
CCGCCTCCGGCCAGGACGCTGGGAGCTGCCTGCGGGAAGGTGCGGGGAGCGGAGCCATGG
CCTCCG
gtgagtgttcatggggcgcgggcctgggccgggggaaaggagctcttctgaagggggtcc
tgccgcagtgagtttagggagctcagtttttgctggggcgcgttctgtctttaaaatctc
atatggtaaaattgtcagcttttaaaaaagttacctgcttcagggtttgcgtgcagaatc
EXON 2  143 bp
gggaaaaaaaggtgcctctcccagccaatctccaagataacatttcggtcttgttattta
atgttaggaggaaaaaaatctttgttttagtctgctgttataaaaaaaacagaatgttaa
aatccattattaattgctatattaatctcactgacctcctcctttttaaaaacttttcag
GTGCGTATAACCCGTATATAGAGATAATTGAACAACCCAGGCAGAGGGGAATGCGTTTTA
GATACAAATGTGAAGGGCGATCAGCAGGCAGCATTCCAGGGGAGCACAGCACAGACAACA
ACCGAACATACCCTTCTATCCAG
gtaatagacccttcttctgtgtctatctcactattagttgcttcatatactagctatagc
aattattttaaagggccagtttcttcacagtcatctccacaggtttatctttttcttttt
tcctttttttttttaaacggatctgtcaaaaagacatctattagatagatgtctaaggac
EXON 3  149 bp
aagtttttctgtactggtattctctggaaagtttcatctaaactgcagttgttcgtcagc
tggattttatttatctagtgccaattacattataattaatgtaaattgaattctcattta
gtagatcagtttataatgcagtctatttggatcatgtatttaatttcccccttttttcag
ATTATGAACTATTATGGAAAAGGAAAAGTGAGAATTACATTAGTAACAAAGAATGACCCA
TATAAACCTCATCCTCATGATTTAGTTGGAAAAGACTGCAGAGACGGCTACTATGAAGCA
GAATTTGGACAAGAACGCAGACCTTTGTT
gtaagtacacagttacagacatcttcagaaataagataagacataggatgttctgtttct
tctccatgacaatctgttactttttagcagaataattttctcattctacttctatttact
gtattttacacttacatttttactatttgcattagaactaccctttcattctttattagt
EXON 4  92 bp
gcgcccagccatataatcccacttcttactctctcatctttatcagagcaattggaagca
cgttcatgctttggtatgtacaactgacagcatgataacttcagtattgctatatgtttg
atttttgcaatattccttgtgtttataatgcagttttgaatattgtttttttcctgctag
TTTCCAAAATTTGGGTATTCGATGTGTGAAGAAAAAAGAAGTAAAAGAAGCTATTATTAC
AAGAATAAAGGCAGGAATCAATCCATTCAATG
gtaagtatgtttgataaaatcatttctatttatttgggtgttgatttctgtttctttttt
ctttctctttttttttttttttttttttttgagacggagttttgctcttgtcgccaggct
ggagtgcaatggcgcgatctcagctcactgcaacctccgcctcccaggttcaagcaattc
EXON 5  141 bp
tagtgattacttgataagaatgataaaaggcattcttgagattgtatactgttctatttt
tattcatacatatttggatgctattcaaggttattggctataatgggcagggaggaggac
ctagcaagtctttaggtctatgtgactattacatttaaaaaattttttttttctattcag
TCCCTGAAAAACAGCTGAATGATATTGAAGATTGTGACCTCAATGTGGTGAGACTGTGTT
TTCAAGTTTTTCTCCCTGATGAACATGGTAATTTGACGACTGCTCTTCCTCCTGTTGTCT
CGAACCCAATTTATGACAACC
gtaagtacttcattttcttatatttgtagtcttaacttgttttttgtaatagtttaattc
ttaaaattattttggtaattaggaaaacaatatattcatgataggaaaacttccagacat
tagagaaatatataacagaaaggaaatcttctctaatctcatcctccagagataatcact
EXON 6  105 bp
aaagtaaagcagttagaaaggaagtggacagataaatagatgattaatgtatttagtgtc
atttatctatacactaaaacttttattctgtgaatgcttttcctcaaattcttccctgca
aaaagaaataaaatattactaaggtagcaactcatttttttgaaaatcctttatatttag
GTGCTCCAAATACTGCAGAATTAAGGATTTGTCGTGTAAACAAGAATTGTGGAAGTGTCA
GAGGAGGAGATGAAATATTTCTACTTTGTGACAAAGTTCAGAAAG
gtatttatttatttcattgaatttagaataaattttagattaatagatgcagttactttg
ttttcccatttttttttttttggtttcttattgactagatgacatagaagttcgttttgt
gttgaacgattgggaagcaaaaggcatcttttcacaagctgatgtacaccgtcaagtagc
EXON 7  213 bp
aggatttgtcgtgtaaacaagaattgtggaagtgtcagaggaggagatgaaatatttcta
ctttgtgacaaagttcagaaaggtatttatttatttcattgaatttagaataaattttag
attaatagatgcagttactttgttttcccatttttttttttttggtttcttattgactag
ATGACATAGAAGTTCGTTTTGTGTTGAACGATTGGGAAGCAAAAGGCATCTTTTCACAAG
CTGATGTACACCGTCAAGTAGCCATTGTTTTCAAAACTCCACCATATTGCAAAGCTATCA
CAGAACCCGTAACAGTAAAAATGCAGTTGCGGAGACCTTCTGACCAGGAAGTTAGTGAAT
CTATGGATTTTAGATATCTGCCAGATGAAAAAG
gtatgacattttgctggtaataatttatatatttcttgaagtggtcctgctaataacatc
ttcttgtaatattcatttgagtacagttatgtatattcataatttatgtttcttttcctg
gaagctttctgttggttttttctttatgctctttgcatctctttatttgttgggttgttt
EXON 8  69 bp
aaaatatccttttctactgatactactgatttgggacatattctataatacttattaaat
ccaacttacatacatatttattgaaaacattttctatatgtgaataaaatatttgtttat
taaaggagaggatacaatcctataattttttatctgctttcctggtttctttctaatcag
ATACTTACGGCAATAAAGCAAAGAAACAAAAGACAACTCTGCTTTTCCAGAAACTGTGCC
AGGATCACG
gtaagaatagtttggatcgattcatatttaaataggttttgttttatttactttattcag
tttttcaaattttattatttttgttttgttttgttgtttgtttgttttttgagatagcat
ctctctctgtcacccaggctggagtgcagtagggcaatctcaactcactgcaacctctgc
EXON 9  96 bp
ttgtttgtttgttttttgagatagcatctctctctgtcacccaggctggagtgcagtagg
gcaatctcaactcactgcaacctctgccccccaggttcaacaattctcctgcctcagcct
cccgggtagctgagattacaggcatgtgccaccacacccggctaatttttgtatttttag
TAGAAACAGGGTTTCGCCATGTTGACCAGGATGGTCTTGAACTCCTGACATCAGGTGATC
CACCCACCTTGGCCTCCCAAAGTGCTGGGATTACAG
gtgggagccaccacgcccggccagtttttcagattttaactgataatgttatttttcaaa
tgacatttaataatggaaaaactttatcctaacagttaattttcctgagagaccaagacc
tggtctcctcggttcaattggagaaggaagatacttcaaaaaaggtattttatttcctat
EXON 10  69 bp
tttcgccatgttgaccaggatggtcttgaactcctgacatcaggtgatccacccaccttg
gcctcccaaagtgctgggattacaggtgggagccaccacgcccggccagtttttcagatt
ttaactgataatgttatttttcaaatgacatttaataatggaaaaactttatcctaacag
TTAATTTTCCTGAGAGACCAAGACCTGGTCTCCTCGGTTCAATTGGAGAAGGAAGATACT
TCAAAAAAG
gtattttatttcctatagcatatttcttgtgatcagaaagaccagtactttgcacaatat
attggaattctatttttaggaatgaataactgcttctttgaaaattttctctccagattt
ttcatgctttcagtatagaatgaattaagcatggcttctgaaggttgtgttagaaactga
EXON 11  1073 bp
ttcattttggattcgtgtaataattttagtgctttttacatttttttatttgaaatgtta
cattggtttccttgacatttttctttatatatatttgtgtgcttatgcaattttaattta
gaaatgctttttataattttgttcattttaatttcgtaaaataaatttttcctcccacag
AACCAAACTTGTTTTCTCATGATGCAGTTGTGAGAGAAATGCCTACAGGGGTTTCAAGTC
AAGCAGAATCCTACTATCCCTCACCTGGGCCCATCTCAAGTGGATTGTCACATCATGCCT
CAATGGCACCTCTGCCTTCTTCAAGCTGGTCATCAGTGGCCCACCCCACCCCACGCTCAG
GCAATACAAACCCACTGAGTAGTTTTTCAACAAGGACACTTCCTTCTAATTCGCAAGGTA
TCCCACCATTCCTGAGAATACCTGTTGGGAATGATTTAAATGCTTCTAATGCTTGCATTT
ACAACAATGCCGATGACATAGTCGGAATGGAAGCGTCATCCATGCCATCAGCAGATTTAT
ATGGTATTTCTGATCCCAACATGCTGTCTAATTGTTCTGTGAATATGATGACAACCAGCA
GTGACAGCATGGGAGAGACTGATAATCCAAGACTTCTGAGCATGAATCTTGAAAACCCCT
CATGTAATTCAGTGTTAGACCCAAGAGACTTGAGACAGCTCCATCAGATGTCCTCTTCCA
GTATGTCAGCAGGCGCCAATTCCAATACTACTGTTTTTGTTTCACAATCAGATGCATTTG
AGGGATCTGACTTCAGTTGTGCAGATAACAGCATGATAAATGAGTCGGGACCATCAAACA
GTACTAATCCAAACAGTCATGGTTTTGTTCAAGATAGTCAGTATTCAGGTATTGGCAGTA
TGCAAAATGAGCAATTGAGTGACTCCTTTCCATATGAATTTTTTCAAGTATAACTTGCAA
GATTTAAATCCTTTTAAATCTTGATACCACCTATATAGATGCAGCATTTTGTATTTGTCT
AACTGGGGATATAATACTATATTTATACTGTATATATAATACTGACTGAGAATATAATAC
TGTATTTGAGAATATAAAAAACTTTTTTCAGGGAAGAAGCATACAACTTTGGACATAGCG
AATACAAAATTGGAAGCTGTCATAAAAAGACAACTCAGAGGCCAGGCGCAGGGGCTCACA
CCTGTAATCCTAGCACTTTGGGAGGCCAAGGCGGGTGGATCACTTGAGACCAG
gaattcgagaccagcctggccaacatggtgaaaccccgtctctactaaaaatacaaaaat
tagctgagcatggtggtacgtgcctgtactgtcagctacttgggaggctgaggcacaata
attgtttgaacccaggaagcagaggttgcagtgagctgagatcacaccaccgcactccag