Gene PTMA Variant 1
DNA : 5.01 KbNT_005403
mRNA : 1202 bp NM_002823
CDS : 333 bp NP_002814
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  226 bp
tcggcgactgcgcagcgcgggacgcgccggggcactgccgctttaagcacgcttgtccat
tgttcggaatcgagccaatgagcgagcgcccgctccctgcgctcagccaatagcggccgg
gcatgggaagccgagcgccgcccactaatctatattaaagcttctggcgccgcgtgagtc
CCCCACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGC
CGCAGCCGCCTCCGCCGCGCGCCTCCTCCGCCGCCGCGGACTCCGGCAGCTTTATCGCCA
GAGTCCCTGAACTCTCGCTTTCTTTTTAATCCCCTGCATCGGATCACCGGCGTGCCCCAC
CATGTCAGACGCAGCCGTAGACACCAGCTCCGAAATCACCACCAAG
gtgaggctggacgccgcccgccccctcggggtccgcgcgccgccgctcgggcggtgtttg
gcgcgcagcagctggactgtctcaagcccgctgttgctccctctcgcggggaaacggccc
gcccccggcgcggtgccctcaggcagcccactctttgtgtggtgcgggggagggggcggg
EXON 2  72 bp
gccttccttccaccagaccagtgggagagggaccgcaggggcatcaggcctttctcaaca
tgcgactcttaatttgggacggacagaacagccgtacagaccagtagttctcagcgcctt
tgcttaccctgggttgctcagaagacttactggttactggttccttcttcccttttgaag
GACTTAAAGGAGAAGAAGGAAGTTGTGGAAGAGGCAGAAAATGGAAGAGACGCCCCTGCT
AACGGGAATGCT
gtgagtgtctgctttgctcctgagccctggcagctaccgccccacaaaatttttcctgtt
ctactttaaacatacctatatatgtgtgtgtatgtgtatatgtatagctttgcacagtgg
cagtatcgtagccaatgagctttacccgaggcgcgattattgctagttaaatatttataa
EXON 3  94 bp
tgcaggtttcatgatggagcctggagggtgttgactggagaagggtctctggggtgggct
tggcttggctgggctgtagatgcagccgccagcctctggtgggaggccgggcatcaggag
caacgctctgtccagcctggggccagctggtaatgacatggcctgttttctgtcgaggag
AATGAGGAAAATGGGGAGCAGGAGGCTGACAATGAGGTAGACGAAGAAGAGGAAGAAGGT
GGGGAGGAAGAGGAGGAGGAAGAAGAAGGTGATG
gtgagtagccttgtctatcttccccttttcaggtactttttcctggccttgtctggcaga
aggggaaggaaggaattggggctcctgggagtgggacaatggtacttggggccagtggac
cacatggccctgggcacccacctgtagagtcagggaaggtctccctgacatggagttgtg
EXON 4  74 bp
tgggcctctctcctctggagagtcccacctgtgtagtgggcgtgggtgccctgattgggc
ccagttgcaggcagtagaggcagggcagggaccttgcagtccactacatgttcctcggga
tttccccaggagccacagtaggagggaagtgtggtttacctggcctttgattctctccag
GTGAGGAAGAGGATGGAGATGAAGATGAGGAAGCTGAGTCAGCTACGGGCAAGCGGGCAG
CTGAAGATGATGAG
gtgggttctggcttgagaagaaggggggtttggcatctgggtctccccacctgcctttag
ctgaggtgctcaagctgcggagggactgtttctgactttgtaggtggccactgtgtggtc
ctgaatcttaagaacaggaaggaaacagggctgggctcaacttcccagaggccttgggct
EXON 5  736 bp
ccactgtgtggtcctgaatcttaagaacaggaaggaaacagggctgggctcaacttccca
gaggccttgggctgtggagctgggggtccctggttcttgctctgccagcaggagctgagg
cagtgggctggatagggctcctggggttggaggggcctttgacagtctttctctgcttag
GATGACGATGTCGATACCAAGAAGCAGAAGACCGACGAGGATGACTAGACAGCAAAAAAG
GAAAAGTTAAACTAAAAAAAAAAAGGCCGCCGTGACCTATTCACCCTCCACTTCCCGTCT
CAGAATCTAAACGTGGTCACCTTCGAGTAGAGAGGCCCGCCCGCCCACCGTGGGCAGTGC
CACCCGCAGATGACACGCGCTCTCCACCACCCAACCCAAACCATGAGAATTTGCAACAGG
GGAGGAAAAAAGAACCAAAACTTCCAAGGCCCTGCTTTTTTTCTTAAAAGTACTTTAAAA
AGGAAATTTGTTTGTATTTTTTATTTACATTTTATATTTTTGTACATATTGTTAGGGTCA
GCCATTTTTAATGATCTCGGATGACCAAACCAGCCTTCGGAGCGTTCTCTGTCCTACTTC
TGACTTTACTTGTGGTGTGACCATGTTCATTATAATCTCAAAGGAGAAAAAAAACCTTGT
AAAAAAAGCAAAAATGACAACAGAAAAACAATCTTATTCCGAGCATTCCAGTAACTTTTT
TGTGTATGTACTTAGCTGTACTATAAGTAGTTGGTTTGTATGAGATGGTTAAAAAGGCCA
AAGATAAAAGGTTTCTTTTTTTTTCCTTTTTTGTCTATGAAGTTGCTGTTTATTTTTTTT
GGCCTGTTTGATGTATGTGTGAAACAATGTTGTCCAACAATAAACAGGAATTTTATTTTG
CTGAGTTGTTCTAACA
aagctgtctcaagcctggtttttctgtttcagtttcttcagaccttccagggcacaagga
taggagggggaggatcctggggacagtgggttgacattttgggaggcagttggatgtgtc
ctgtgatgggcagcagagtctggtgggtgggcagggactgagctgcagttggctgggggg