Gene POU3F3 Variant 1
DNA : 1.50 KbNT_022171
mRNA : 1503 bp NM_006236
CDS : 1503 bp NP_006227
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  1503 bp
cggaggaggaggcggcgaaggcggcggggccggcgggggcccggggcgggggcggggaag
gagggggggaggaggcgggaggcggggggcgcggcggcggcggcggcggcggcggccgcg
gctgctgctgcggcggcggcggcggtggtggcggcggtggggtggcgggagcggagcggc
ATGGCCACGGCGGCTTCTAACCCCTACCTGCCGGGGAACAGCCTGCTCGCGGCCGGCTCT
ATTGTGCACTCGGACGCGGCAGGGGCTGGCGGCGGCGGGGGTGGCGGCGGCGGCGGCGGC
GGGGGCGGCGCAGGGGGCGGGGGCGGCGGCATGCAGCCGGGCAGCGCCGCCGTGACCTCG
GGCGCCTACCGGGGGGACCCGTCCTCTGTCAAGATGGTCCAGAGCGACTTCATGCAGGGG
GCCATGGCCGACAGCAACGGCGGCCATATGCTGAGCCACGCGCACCAGTGGGTCACAGCC
CTGCCCCACGCCGCCGCCGCCGCCGCCGCTGCCGCCGCCGCCGCCGTGGAGGCGAGCTCG
CCGTGGTCGGGCAGCGCCGTGGGCATGGCTGGCAGCCCCCAGCAGCCACCGCAGCCGCCG
CCGCCACCGCCGCAGGGCCCCGACGTGAAGGGCGGCGCCGGGCGCGACGACCTGCACGCG
GGCACAGCGCTGCACCACCGCGGGCCGCCGCACCTCGGACCCCCGCCGCCGCCCCCACAC
CAGGGCCACCCTGGGGGCTGGGGGGCGGCCGCCGCTGCCGCAGCCGCAGCCGCCGCCGCC
GCCGCCGCCGCGCACCTCCCGTCCATGGCCGGGGGCCAGCAGCCGCCGCCGCAGAGTCTG
CTCTACTCGCAGCCCGGAGGCTTCACGGTGAACGGCATGCTGAGCGCGCCACCGGGGCCC
GGCGGCGGCGGCGGCGGCGCGGGCGGTGGAGCCCAGAGCTTGGTGCACCCGGGGCTGGTG
CGCGGGGACACGCCAGAGCTGGCCGAGCACCACCACCACCACCACCACCACGCGCATCCT
CACCCGCCGCACCCGCACCACGCGCAGGGACCCCCGCACCACGGCGGCGGCGGCGGCGGC
GCGGGGCCTGGACTCAACAGCCACGACCCGCACTCGGACGAGGACACGCCGACGTCGGAC
GACCTGGAGCAGTTCGCCAAGCAGTTCAAGCAGCGGCGCATCAAGCTGGGCTTCACGCAG
GCCGACGTGGGGTTGGCGCTGGGCACACTCTACGGCAACGTGTTCTCGCAGACCACCATC
TGCCGCTTCGAGGCCCTGCAGCTGAGCTTCAAGAACATGTGCAAGCTCAAGCCGCTGCTG
AACAAGTGGCTGGAGGAGGCGGACTCAAGCACCGGCAGCCCCACAAGCATCGACAAGATC
GCGGCGCAGGGCCGCAAGCGCAAGAAGCGGACCTCTATCGAGGTGAGCGTCAAGGGCGCG
CTGGAGAGCCACTTCCTCAAGTGCCCCAAGCCCTCCGCGCAGGAGATCACCAACCTGGCC
GACAGCCTGCAGCTCGAGAAGGAGGTGGTGCGGGTCTGGTTCTGCAATCGGCGCCAAAAG
GAGAAGCGCATGACGCCGCCCGGGATCCAACAGCAGACGCCCGACGACGTCTACTCGCAG
GTGGGCACCGTGAGCGCCGACACGCCGCCGCCTCACCACGGGCTGCAGACGAGCGTTCAG
TGA
agccagggcgcagagcgaagagggccgccgccgccgccgcctccgcagccgccgtcagca
ccgccgccgcccctgccgccgccgccgccgccgccgccgccgctgccgccgccgcgccga
ccctgcacctgggccgctccgggctccagcccaggcccatccgccgccctcccctccacc