Gene PLEK Variant 1
DNA : 32.16 KbNT_022184
mRNA : 2747 bp NM_002664
CDS : 1053 bp NP_002655
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  102 bp
ggttttaataagtctccagcattagcaaggaatgggtggtttactctgcagttccttatt
ctgatcttccaacccagtgaggggaagaggatgtgatcatgcgaccgccagcagaaggga
aattgtgaaagcgacctgctgtagaaaaggcggcccacagccacctcagcatgcagagga
GGCCCAGCTGCTGAGAGGAGTTGCCTGAGAGTGACCTTTGCATCTGCCTGTCCAGCCAGC
ATGGAACCAAAGCGGATCAGAGAGGGCTACCTTGTGAAGAAG
gtgagcgaaggtgccacttaccagggtgtcagtggacatgggctggggagacttgggttc
agctccaccggctacctgctcatcttaggaatgtttcctgttcaaccagttgggttgaaa
taggggagcgtggtagcacatagaatgttggagtggggttaggggagtggggatactcat
EXON 2  156 bp
aatgagaatggctccccaagtagccactgatttgagaggatttgtgttgaaggaacagag
atgatgtcaccaaacattttaaaaaccaactgtaagtaaatatagaatctttcctgttag
gaggaaaatacagtttgcaaagagccctgtccatctcagctcttttggttgtcattacag
GGGAGCGTGTTCAATACGTGGAAACCCATGTGGGTTGTATTGTTAGAAGATGGAATTGAA
TTCTATAAGAAGAAAAGTGACAACAGCCCCAAAGGAATGATCCCGCTGAAAGGGAGCACT
CTGACTAGCCCTTGTCAAGACTTTGGCAAAAGGATG
gtaagttgacatcatgagctgccgtgaacccctggtcaggcactcaacttttggtgcaag
cattgcctacaatgtgggtggtgctccttgggctggtccctctcaccaccacccacaccc
caccctggcatttgggtttctcttggctagaagaggtttaggccaatggcctctgcttca
EXON 3  182 bp
gcattgcctacaatgtgggtggtgctccttgggctggtccctctcaccaccacccacacc
ccaccctggcatttgggtttctcttggctagaagaggtttaggccaatggcctctgcttc
atgaggggccccaagcccttgaaataagccatttctaatgggatgtgttttgattttcag
TTTGTGTTTAAGATCACTACGACCAAACAGCAGGACCACTTCTTCCAGGCAGCCTTCCTG
GAGGAGAGAGATGCCTGGGTTCGGGATATCAAGAAGGCCATTAAATGCATTGAAGGAGGC
CAGAAATTTGCCAGGAAATCTACCAGGAGGTCCATTCGACTGCCAGAAACCATTGACTTA
GG
gtgattttctgtgtttacttctctttacccattccttctgaaagacacaaacatagcaga
tcctgctccaaggcttgctttgaccacctctgatgttgtatccactctgccaggtcaata
ctggcacttggtgtactaaaatgtttacctgggtctgaaggagtgatccaaggcctacta
EXON 4  92 bp
tgaatgttgcccctccactacttatgatctgatggagggagattaagctcaggggatacc
tggggtgggggagcttgtgctcacctcccagagagaacttaccattctgaaatgttcccc
actcatccaactgggtttttttttgtttgtttgtttgtttgcttttttatctctgtgcag
TGCCTTATATTTGTCCATGAAAGACACTGAAAAAGGAATAAAAGAACTGAATCTAGAGAA
GGACAAGAAGATTTTTAATCACTGCTTCACAG
gtaaaagcacttgcaggcctgaaatagggcgactgggaaggcgatatggagtcctccttc
ggcctcgtctgtgaggtgggggtatgaagtatgggggttggaaggggtcccagaatgcag
cctggtgagcctgaggatgaagctcctacagagtgaaaatagaaagaagtttgttgttca
EXON 5  185 bp
gtttgtttgtttgtttctagtgggtatctatcccacttattttgttttctctttcttgaa
ataacaggggagacgagacaagtcagacctgtgggtgagctggagtcagttcaggggtga
ttgtcaggggcttgttcttcggtaaggagagttaaccttccctgtgctggtcccatctag
GTAACTGCGTCATTGATTGGCTGGTATCCAACCAGTCTGTTAGGAATCGCCAGGAAGGCC
TCATGATTGCTTCATCGCTGCTCAATGAGGGGTATCTGCAGCCTGCTGGAGACATGTCCA
AGAGTGCAGTGGATGGAACTGCTGAAAACCCTTTCCTGGACAACCCTGATGCCTTCTACT
ACTTT
gtaagaaaagctccccatctcttcttcctgtaagggaggctgccctgagcagattctaga
ttgatttcagttcatagacatctatagagcgctgttaggcagcgggtagggaggtcagcc
aggaagaacaagggaatacctgaagctcccaggcccatttagagcttctgttataccagc
EXON 6  105 bp
aaaggaggaggagaaactcgctcatcaaggacctttgaagttcagattgggatgtacaca
ggaatggaggaaaaaggaggaggctgccctcatggctggaggggagggggaatggagatg
gcacaagttgcaatgtgcctaagactggtgatgttagcttgctgtttgattttccaacag
CCAGACAGTGGGTTCTTCTGTGAAGAGAATTCCAGTGATGATGATGTGATTCTGAAAGAA
GAATTCAGAGGGGTCATTATCAAGCAGGGATGTTTACTGAAGCAG
gtgagtggccacaactgctcccatctagccttttccctttacaaggtcctttttgtttct
aagttacccagtgacttttggtttgtttggttaatagtcaagcagaaaatgaaacccaca
aagtgaaagatagatgagtagctctttagatatcaaagtggctttagatcaggaagattg
EXON 7  84 bp
attggctgtagcactatctccctgacaaagacctaggccgggatattgttatcctggagt
tagtatttcattttctctttcttttctcaattcagcaaataattattctgtaggtattgt
ttgtacagagtgatgctgggaattcaccatcccttcttttaatgttgatcctggatacag
GGGCATAGAAGGAAAAACTGGAAAGTGAGGAAGTTCATCTTGAGAGAAGACCCTGCCTAC
CTGCACTACTATGACCCTGCTGGG
gtaaggtcctgtggttcataaatccattcaaataaataaatccactgcatttataatctg
ggcttcctattcccctctctactctgttgatatcccctttttctctttactggcccactt
ttttttctcccattctcctctacctttttctatcccctttcaatgcaaagatctgagatc
EXON 8  70 bp
gtggaggatctggaaggaccttagatctgtcagcagtttttctttaatctccttctgctc
ttacttattttggggggccctgatctatattagagtgagtctggctttttcaccaagagg
atgaggtctatctatactctgcattttggaaacataatgaacaactcctttcttctttag
GCAGAAGATCCCCTGGGAGCAATTCACTTGAGAGGCTGTGTGGTGACTTCAGTGGAGAGC
AACTCAAATG
gtaagatgaatttctgtgtgagagaggtgggtctgctcagactcccctcccacacctgga
catcctgggccaacattaatcaatcaatcaattaatcaggataagcaggaatggggcagg
catggtggctcccacctgtaatcccggcactttgggaggccgaggagggcagatcacttg
EXON 9  1771 bp
atgtatataactgtgcaatgaattatcctataatcataccttgtttgtatgtttgaaagc
cacatagtcaatttccttagaacacgaagaaaacagagatttcatggcttgcagaggagg
gtggagcaagtggtctttctgatgcctgtgcgtgctgccatttgccttctctttccccag
GCAGGAAGAGTGAGGAAGAGAACCTTTTTGAGATCATCACAGCAGATGAAGTGCACTATT
TCTTGCAAGCAGCCACCCCCAAGGAGCGCACAGAGTGGATCAGAGCCATCCAGATGGCCT
CCCGAACTGGGAAGTAAAGAGACTCCTGCATTCCTCCTCCCCTCCTGAGGGAAGCCCATG
GACAAGCTCAGTCCAGGACCTGTCCACTTCTGTGACAAATCAACGGGAAACAGCCCAGGG
GTGGGAAGTTTTCATTTGCAGGGGGGTCTGAATGTAACTCACCATGTGGTGTGCAAGGTT
CCCCTGCATTGTATTGCTCACTGCAGCCCCTCTGCCCCTATCCATGACCCCCAAGCAGAT
ATAACAAGCTGTGCAGCCTCAGTAGGCTGCTTGCCCTCTCCAGGCCTCAGGGCCTCTTCT
GGAAAATGAAGAAATTCAACTAGTAGATTCCTGAGGTCCCCCTAGCTTAAAAAAAAAAAA
AATCTGCCCCATGATTCTAACACTCGCAGTAGTGATAGTGTATCTAGTTGTTCTGCTGGT
GTCCTTCCTTGGCTAAGTCTTGGCCTTCAGTTATCTTCAAATGTACCAGAACCTGAGCCA
ACGCCTCCCTGTGAAACTGTTGCTGATCTGTAGTACAGTACCAGGAAGAAACCTCTTTTG
TTCTCTTTAGACATCTTCTACTTGCTCTTGGCCTTGAGATCGTGTAACAAAATGAAGGAG
GGCTCTCTTCTTTCTTCCTCATCCTACTCAAAAACTTCCCGAGAGCAGTGGTGGTTTTGA
GGGTTTTGACTTCTATTACTTTTGGCAGCCTGGAAAGTTGTGTCTTCTGGGAAAGAGACC
TGGGGAGGCCAGGAGTAGCTGAGGGTCCTTTCTGTGCCCTTAAACCGCCCAGAGGAGCCC
TATTCCACTCTGGTTTTAGGCTGATCTGAGAGGGTCTCCCTTTGTTCCTTTCTGGAGCAT
TTCTCTAACGTTTATTACAATTAGGAGGGGGACCCCACATCTGTGAGATTCTGTTTCATT
TGAGGTTTACAGAAAAAAAAAAGTGGCCAGATGTGTTCCCCCCATGGGTGAGAGGCCTGG
GCAACTGCCTGGTGAATGTGTCTTGCGGCAGCTGCAGCAAGTGGAGGGGCTGAACTACTG
GCCAGCTCACTGGATGATGGGTTAATACAACAACTGCACTGTAAGGACTCAGAGCCACAC
AGAACTTCTGAGAGGGGCTGTTAGCATTGCGCAGCATCTTCAGTTCTCCAGTAAATGATA
TTGCGTTCGTGCCTCAGCTTTAAGCACAAGTAGCAGCAGCTCCTGCTTGAGTTCTGAGGG
CATCATGGCCCTATGATTAACCAGAGTGATCTAACCTAGACTAAAATTGGGAACTTATTT
GCAATTTTTGACCCTGACCACTAACTAGTGATTCTTCTCCAAAATTGAGAAAGACAGCAC
CCATTGAAGCAGATATGTGTGTGAAAGTATATTTTTCAATTCCAGATTTTTAATTTTAAG
GCTCCAGGAAAGAAAGGAGAGTAGAACATTTTTCCTCATTTTATCAAATCCTCTCTTGCC
CTCCCTCAATTCCCCTGTAACATTCCTGAAGCTGTTCCCACTCCCAGATGGTTTTATCAA
TAGCCTAGAGGTAAAGAACTGTCTTTTTCTCTGATTCTTTAATAAATTATCTTTATAGAA
TATGCACAAGTTTTTCTACACTCAGTGTTAAAGTATTTATTAATGGGAAGTCAACTTAAT
GTTTTGAAATAAATATATGACTCTGTTTAAT
gcatttttggtgtgatgactctgttttgcctcctattgataactctcccctctggccggg
cacggtggctcatgcctgtaatcccaatatttgagaggccaaggcgggtggatcacttga
ggtcaggagttcgagatcagcctggccaacatggtgaaacactgtctctactaaaaaaaa