Gene PKP4 Variant 1
DNA : 223.73 KbNT_005403
mRNA : 3854 bp NM_003628
CDS : 3632 bp NP_003619
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  122 bp
ggcagcggggcgggcggcggcggcggcctctgggcagtagagggggctccggggctgagt
ccgcgtcgacgccggccgcggaggcggcaccatgggcaaggggtagaggggcaagttggc
caccgccgccgccgggggtggtgggagagccgctccgggggcgggggccggtgggggagg
GAGGGGCGGGCAGCCGCGCCGCCGCGGCACTTTTTTAATTTTTTCGGGTGCCGCAGCGGC
GACCCCTCGGCGCCGATGTCCCTGATCCCTGGAGCGACGACGGCCGCTGCCTAAGCTGGA
AA
gtaagtgtgtgggctcgcgggagggcgcggagactcctgcccacgagaccctcggccctc
gccccgaacacgcgccagggccaggacctgcgcgccgggggccgggggcctccctcccgc
tgccgcgtccccagcgcctcgcggccgccgcggctttcctgccccgcctcgtgttcctgc
EXON 2  137 bp
tgataagttagtcatatttacttattggttacctgtttagaaaatttagcaatttcacaa
gtttttgatcatggtgtgtagactgtagtctactgtagttgctaggaaccatctgtaaag
ccttggttcctgcaagggagcccagaagaaagtgttaaccctttgcctgcttgattgcag
GAGGAATGCCAGCTCCTGAGCAGGCCTCATTGGTGGAGGAGGGGCAACCACAGACCCGCC
AGGAAGCTGCCTCCACTGGCCCAGGCATGGAACCCGAGACCACAGCCACCACTATTCTAG
CATCCGTGAAGGAGCAG
gtacatcctcgtattgaaagttgcagtgaattatttctttaatgcctttaaaaaattaat
ctttggatatgttttaaatttgtgtaacgtccttgacgccttcacgttttctaattataa
ggtgtttacatccctgagtacattgggatgactggcatgtagagccgctccaggtgccag
EXON 3  113 bp
tgaaaaagctaggaatcaataggtcatttatttcatccaaaaattgcatttcacaaagcc
acaccatagctttatgttatgggtacgttcctatgtttcctgtgacatacattaattcat
atatctgcctgagcagcataccttggcgccttatatgccttttattttcttgaatcacag
GAGCTTCAGTTTCAGCGACTCACCCGAGAACTGGAAGTGGAAAGGCAGATTGTTGCCAGT
CAGCTAGAAAGATGTAGGCTTGGAGCAGAATCACCAAGCATCGCCAGCACCAG
gtacagggccaatggctccatctttatgcacactcaagttacatgccttactaggttgtt
ctctatgcagcaaaagattctgttagtgttgttactgttaacttgccttccagaatttga
aaccaaaaatgtccatttattctaattttgagaagcctcttgcaatccctcagtcctgtg
EXON 4  35 bp
ttgtcccaattttaaatactatctaaaaattaacttagataagtttaaattttatttaag
gtttttgtgctcttgtataatttaatgtggaaattaaatgttaatatgcaaaacaggtcc
taagctaaattttatgacaaaataaataaatgttccatttttttctttctttttctttag
CTCAACTGAGAAGTCATTTCCTTGGAGATCAACAG
gtatgttttttattatataaaagttatgtttgataaacacaaattacatagcctactctc
ttaacttactatctcttggtgaaataagccaagcaaagcctttaatagtgacaatattgc
gctacattgctttggaatagtacttaatatgcttaagtttttagtataattgagtaaatt
EXON 5  132 bp
agtataagtatatggaacacattcatatagttaagagtcagatgtgctgtgtaagctgaa
aataatagccttgtattagcatatagattctaagatgctgttgacaaacatctgaacctt
ttttagcaagtttttatgtaatgttattatatttagctgattaaacttttcttgttacag
ACGTGCCAAATACTGGTGTAAGCAAACCTAGAGTTTCTGACGCTGTCCAGCCCAACAACT
ATCTCATCAGGACAGAGCCAGAACAAGGAACCCTCTATTCACCAGAACAGACATCTCTCC
ATGAAAGTGAGG
gtctgttgtgttatcttttaagtactggatttgcttttaagattttattcttgaaagcga
gtgtcagaagtgtgtataataaagatatttcttggtttcattcttacaggatcattgggt
aactcaagaagttcaacacaaatgaattcttattccgacagtggataccaggaagcaggg
EXON 6  191 bp
tctcatcaggacagagccagaacaaggaaccctctattcaccagaacagacatctctcca
tgaaagtgagggtctgttgtgttatcttttaagtactggatttgcttttaagattttatt
cttgaaagcgagtgtcagaagtgtgtataataaagatatttcttggtttcattcttacag
GATCATTGGGTAACTCAAGAAGTTCAACACAAATGAATTCTTATTCCGACAGTGGATACC
AGGAAGCAGGGAGTTTCCACAACAGCCAGAACGTGAGCAAGGCAGACAACAGACAGCAGC
ATTCATTCATAGGATCAACTAACAACCATGTGGTGAGGAATTCAAGAGCTGAAGGACAAA
CACTGGTTCAG
gtaagccaaacgcatcaagatctctgcaaagaaataccttccggccgggcacagtggctc
atgcctgtaatcccagcattttgggaggccgaggcgggtggatcacctgaggtcaggagt
tcaagaccagcctgcctaacatggcgaaaccccgtctctactaaaaatacaaaaattagc
EXON 7  550 bp
caactaaagcaccgtgaggaaaaattaatgtctggctcaaagcataaaaaggaaaagaat
cttagatgcctaaaatagtggattcacattctgtagtgagctatgtgtatttcttttgta
atggcaatgaacacaaaaccctggataaacccattctcttttttccccccctttcatcag
CCATCAGTAGCCAATCGGGCCATGAGAAGAGTTAGTTCAGTTCCATCTAGAGCACAGTCT
CCTTCTTATGTTATCAGCACAGGCGTGTCTCCTTCAAGGGGGTCTCTGAGAACTTCTCTG
GGTAGTGGATTTGGCTCTCCGTCAGTGACCGACCCCCGACCTCTGAACCCCAGTGCATAT
TCCTCCACCACATTACCTGCTGCACGGGCAGCCTCTCCGTACTCACAGAGACCCGCCTCC
CCAACAGCTATACGGCGGATTGGGTCAGTCACCTCCCGGCAGACCTCCAATCCCAACGGA
CCAACCCCTCAATACCAAACCACCGCCAGAGTGGGGTCCCCACTGACCCTGACGGATGCA
CAGACTCGAGTAGCTTCCCCATCCCAAGGCCAGGTGGGGTCGTCGTCCCCCAAACGCTCA
GGGATGACCGCCGTACCACAGCATCTGGGACCTTCACTGCAAAGGACTGTTCATGACATG
GAGCAATTCGGACAGCAGCAGTATGACATTTATGAGAGGATGGTTCCACCCAGGCCAGAC
AGCCTGACAG
gtgcgtacaaggtgacagtgctacataaaacccagtgaggaaatcttctgtgtaacttaa
gttgaaacaaagaatgaaaaggtggaaaaggctcattcgtgtttttaatctcagatttta
aactataaacttaaggttaacttgtctttcaggttctgtaattcttaatacatgaaatta
EXON 8  189 bp
gtagagatggggtctcactctgttcccagactggtctcaaattcctgggctcaagccatt
ctcccacctctgtctcccaaagtgctgggattacaggggttaggaatttaattagggttt
atgtttttaacctcactgtgattgtctcagttcttaacgatgtaatttttgtgcctctag
GCTTACGGAGTTCCTATGCTAGTCAGCATAGTCAGCTTGGGCAAGACCTTCGTTCTGCCG
TGTCTCCCGACTTGCACATTACTCCTATATATGAGGGGAGGACCTATTACAGCCCAGTGT
ACCGCAGCCCAAACCATGGAACTGTGGAGCTCCAAGGATCGCAGACGGCGTTGTATCGCA
CAGGTTCAG
gtgggcatcaactctgtttactggtttcctgatttcataggccccacagtagaagtgttt
tattgagattgggttccctgttagaaggaaatcatgttgcccatttggttgtcagataag
cagctgtgacagcagatcaataagcaataaaacaggttcatttagtacctatttataggt
EXON 9  217 bp
attaaaaacttaagtaccctttttagcactaataaggtagaattttaaaatctaaaagta
agcgatttatataattgccaaaaaatatagtccttaaaattaaaaatgttttacctttaa
ttaaagtgtgatctcatggagaacatactaatctttttcaaaatgttgactttctagtag
GTATTGGAAATCTACAAAGGACATCCAGCCAACGAAGTACCCTTACATACCAAAGAAATA
ATTATGCTCTGAACACAACAGCTACCTACGCGGAGCCCTACAGGCCTATACAATACCGAG
TGCAAGAGTGCAATTATAACAGGCTTCAGCATGCAGTGCCGGCTGATGATGGCACCACAA
GATCCCCATCAATAGACAGCATTCAGAAGGACCCCAG
gcgagtaccagttaggagtctctagaaggctacagtattgcaggagtcagccagttcctc
cattttgacttttttaagttgctaagtctattatactatcattatactatcattaattcc
atatatattaatacttccagttgtattccagctatataggtcattgaggttaatttcatt
EXON 10  133 bp
catctgggcctctgcatatgttcatcagggggaaaaattatttaggtatgtattttttag
gatttttgtaacttcccatttttgtctcagctgagctttttttccttataccaagtgttt
ttttcagtgtatttttacaacatgggccttcctttctgaagccatgtttttctcatgtag
GGAGTTTGCCTGGCGTGATCCTGAGTTGCCTGAGGTCATTCACATGCTTCAGCACCAGTT
CCCATCTGTTCAGGCAAATGCAGCGGCCTACCTGCAGCACCTGTGCTTTGGTGACAACAA
AGTGAAGATGGAG
gtacaggacatggtgcctgggatgactggggaaaataatgcctttgcatttaacagccac
gtgcttctgtatttaagaaattacccagtgtaattcaagagtctttttaaagggatattt
tgataccagatactctttcacttaactatgcatttcagtatctctcaggaaaaactagga
EXON 11  214 bp
gagccaccgcacctggcctctccttagaatgtataaaagttgtcttatttggaataaaaa
gtaacctttgaaatggtctagagatatccacatcctgtgatctctccataacggacttct
gtatgatcactgattaattgcatgttacttaggcctggtacctaatatttttcattctag
GTGTGTAGGTTAGGGGGAATCAAGCATCTGGTTGACCTTCTGGACCACAGAGTTTTGGAA
GTTCAGAAGAATGCTTGTGGTGCCCTTCGAAACCTCGTTTTTGGCAAGTCTACAGATGAA
AATAAAATAGCAATGAAGAATGTTGGTGGGATACCTGCCTTGTTGCGACTGTTGAGAAAA
TCTATTGATGCAGAAGTAAGGGAGCTTGTTACAG
gtaggtatagaatgtgatctcgtcctagaggaaatgttgaaaacagtctggactgtgccc
ttgtatagtggcactatggaagagttggaggttccaggtaatagataatgagatatatat
agtgctcacaactgtgaaggctgagaattatttagtctaatgagtcagaaaccgtttaga
EXON 12  184 bp
cggaggctcataccttcactcaaaactcattagaggtctattcccaccctggttgcaaat
ataggccatagattaggtttggaacagactgacttcatattaattagagctaatacgttt
attttatttctaaagccacaggatctctatttgtttgattttttaaatctccttttttag
GAGTTCTTTGGAATTTATCCTCATGTGATGCTGTAAAAATGACAATCATTCGAGATGCTC
TCTCAACCTTAACAAACACTGTGATTGTTCCACATTCTGGATGGAATAACTCTTCTTTTG
ATGATGATCATAAAATTAAATTTCAGACTTCACTAGTTCTGCGTAACACGACAGGTTGCC
TAAG
gtaaattctttatttcttctttccagttaattctgtgattaaatatgtgtcataggtaaa
ttgattttaggaggacttactttattaacatctatctaagtttccagtttttatttcaaa
atttaggccactggactttgttattctgggagaaaaacatcgtgagcacagacttgtggc
EXON 13  118 bp
aatggggagcgggccatcattgtgagcttcaggatgttaccatgcaagcccccagtgcct
cctccgacctctaagtggctgccacctgttgttcgctctctcagatccttaaggttaagt
ccacgtggctgatgagtgcatggttcatctcagcagctcctcctgtctccacccctttag
GAACCTCAGCTCCGCGGGGGAAGAAGCTCGGAAGCAAATGCGGTCCTGCGAGGGGCTGGT
AGACTCACTGTTGTATGTGATCCACACGTGTGTGAACACATCCGATTACGACAGCAAG
gtcagtgccggcctggttgcaggagggcgtggtggcaggtgaccatgatgcctggtgcca
ctatttgcatgccattggttctttctgacctgcggatcctgtcctcctcaggaggccact
ctccagatcaaagggcaagtctccaaagttacaggggcaaggacgtggcaacttaagaaa
EXON 14  191 bp
ctgggtattccacaaacactctagaatcataattctctcttcagattgtttcaagttctc
ataaataaaaagtagttctttcatatttcccatttatttcctgtctgtagtgttcagtac
agaagtgttttgctctaatgtgccgagttgtttttaattatacgccatgctgggtttcag
ACGGTGGAGAACTGCGTGTGCACCCTGAGGAACCTGTCTATCGGCTGGAGCTGGAGGTGC
CCCAGGCCCGGTTACTGGGACTGAACGAATTGGATGACTTACTAGGAAAAGAGTCTCCCA
GCAAAGACTCTGAGCCAAGTTGCTGGGGGAAGAAGAAGAAAAAGAAAAAGAGGACTCCGC
AAGAAGATCAA
gttagcattttattttatatgagactctcaagtttaatttttctgggagtgaggaatcac
atatttggcaagaaaataaattttctgcatagctatagctgagtcccgcaaaggtgaatg
ttttcaagtattggagatcatgttcattctgcctccatttaacgtgtgctgtttgtcttt
EXON 15  174 bp
agcattttattttatatgagactctcaagtttaatttttctgggagtgaggaatcacata
tttggcaagaaaataaattttctgcatagctatagctgagtcccgcaaaggtgaatgttt
tcaagtattggagatcatgttcattctgcctccatttaacgtgtgctgtttgtctttcag
TGGGATGGAGTTGGTCCTATCCCAGGACTGTCGAAGTCCCCCAAAGGGGTTGAGATGCTG
TGGCACCCATCGGTGGTAAAACCATATCTGACTCTTCTAGCAGAAAGTTCCAACCCAGCC
ACCTTGGAAGGCTCTGCAGGGTCTCTCCAGAACCTCTCTGCTGGCAACTGGAAG
gtaggatgacttccacttatctacacttctttccatctttgcaaactaacttgaaatgtt
atatatatatgttctgcctcagtcagatcagccctgatggtgaaagggtcacagctactt
agcttgtgtgtgaaggggttaaagggaaaaaagggagacaagcagttgctctggggatac
EXON 16  151 bp
agcctatctttctccccaactttggttttctcttcactgacaccacagatttgatcttca
attggaaagaaaccatttaatctattagttcatcttttggaaacatcttttttaggtgac
agtaacatatgagactggaactctgttttatgttacttcctgccttatttttctcactag
TTTGCAGCATATATCCGGGCGGCCGTCCGAAAAGAAAAGGGGCTCCCCATCCTTGTGGAG
CTTCTGAGAATGGATAACGATAGAGTTGTTTCTTCCGTGGCAACAGCCTTGAGGAATATG
GCACTAGATGTTCGCAACAAGGAGCTCATAG
gtatgttctggtgacaagatgagctgtaaatgtgagagcagctacaaaattcatgaaact
cttcttttgattaataaatatatggcttgtaaaatcattaacagctgagccctagtctcc
agtttcttggcatatttgagtactcctgttttgtgaccattctttttcagcaggaggcaa
EXON 17  196 bp
gctttccccttataatgacatttgtccttttcttctttgccatgggttttgattttttcc
cctattattgtctctttgggggttttatttttaagagattgcatgccaccagaatctgaa
caacaataacaaaaacctagtaccttctggaagtagaatttactcttttgccgttggcag
GCAAATACGCCATGCGAGACCTGGTCAACCGGCTCCCCGGCGGCAATGGCCCCAGTGTCT
TGTCTGATGAGACCATGGCAGCCATCTGCTGTGCTCTGCACGAGGTCACCAGCAAAAACA
TGGAGAACGCAAAAGCCCTGGCCGACTCAGGAGGCATAGAGAAGCTGGTGAACATAACCA
AAGGCAGGGGCGACAG
gcaagtctgcggcaaggaggtgcaagcagtgctcttattcctgagattgtcctgtgatga
ggcctttgttgaggatacctttcctattggaaaggatttatttttgcatttcttacatgc
cgataagctaagcagtctccagcacttacaacctgctatgctgggagaagtgttttctgt
EXON 18  85 bp
ttccgaacctgatcgactcccaggcacacctggtccctttgtggtgtgtcctgcagtagc
ctccatccctgtggccctgagagcgatggcctgttggccactgattttcatcctgcaccc
ctctgagtggggctgaggctgtgtcacccacattcattaatatccttgctctctacctag
ATCATCTCTGAAAGTGGTGAAGGCAGCAGCCCAGGTCTTGAATACATTATGGCAATATCG
GGACCTCCGGAGCATTTATAAAAAG
gtaacctacaagaatagctctggcataattagcattcatcagagcacacactcataatca
tttattgtaatgaaatgtcattattcattttgagaggtttctttttctcttaactctgca
ggatgggtggaatcagaaccattttattacacctgtgtcgacattggagcgagaccgatt
EXON 19  118 bp
cagcccaggtcttgaatacattatggcaatatcgggacctccggagcatttataaaaagg
taacctacaagaatagctctggcataattagcattcatcagagcacacactcataatcat
ttattgtaatgaaatgtcattattcattttgagaggtttctttttctcttaactctgcag
GATGGGTGGAATCAGAACCATTTTATTACACCTGTGTCGACATTGGAGCGAGACCGATTC
AAATCACATCCTTCCTTGTCTACCACCAACCAACAGATGTCACCCATCATTCAGTCAG
gtcagtgggaaaatgccactccttggcgagaacctttgtgtgacagaacattgttcccca
gccagagaagatcaaacataagctggttaagcctgtcatctccaacactacccatgcagc
agagaaccttctgtaggaatcacacaccattataaaccacaagcccactttcttcctttt
EXON 20  129 bp
acttgcagtacttgggtctagctgctcttccactcccagcacctctgagatattttcagc
accagctgtgtgtcatttctagttactgagctttgtgtttctggagaggattttccacag
atactgatgctgatttctctttctacccctctttctctcctcctttgcctctcccttcag
TCGGCAGCACCTCTTCCTCACCAGCACTGTTAGGAATCAGAGACCCTCGCTCTGAATACG
ATAGGACCCAGCCACCTATGCAGTATTACAATAGCCAAGGGGATGCCACACATAAAGGCC
TGTACCCTG
gtaagacgccagttgggtgtgtgatacagtctcttgaaaagccgcatttccaggcgcttg
gccagtggcctgggaagtagcctgtgcttgtattgagacagtcccccagcagcaaaccat
gttccagtcattccctttcctactttggggattgttgccttttctgcttgtttaaagtaa
EXON 21  74 bp
taagcagcagccaggccagatccagggaccctgagctgctacctctcccagcccgcattg
gcactggggaagacaggccctgtcggggacagtgctagccctagtgcaggggagaccacc
cagcctaatggaccagagtaataagcactagttttaatttcataaaatattttcttacag
GCTCCAGCAAACCTTCACCAATTTACATCAGTTCCTATTCCTCACCAGCAAGAGAACAAA
ATAGACGGCTACAG
gtgaatttgcaatatcatttttacagaaggctgattagcagttaacacagtaaggggtcc
acgtcgattgacttcccagagctgggccaacatggcagggtcctagatgctttccctggg
gatcttcactccttggaaactcaacgtgtggtttaagcaaagcatttccacggtagcctc
EXON 22  401 bp
taaaatccttagagtccaatagtaaacgcatagtgtgcaccagaaacagcttttaacctt
aaactgcaaatattgaatattgctttaaaaatatgaagcaggaagcccacattaattttc
ctaacacatgtatttttaaaaaattgcttttatttatttgccttttcattttgtcaacag
CATCAACAGCTGTATTATAGTCAAGATGACTCCAACAGAAAGAACTTTGATGCATACAGA
TTGTATTTGCAGTCTCCTCATAGCTATGAAGATCCTTATTTTGATGACCGAGTTCACTTT
CCAGCTTCTACTGATTACTCAACACAGTATGGACTGAAATCGACCACAAATTATGTAGAC
TTTTATTCCACTAAACGACCTTCTTATAGAGCAGAACAGTACCCAGGGTCCCCAGACTCA
TGGGTGTAGCATCAAGATGCCCAACAGAGGAACTCTTTCTTTCTAACCTTGTTCAGATTG
AGGTGAAAAGTCCATCTTGCTGATTTGATGATTGAAATGTGAAAGTGAAGTGGAAGGAAT
GAATGAAGTGTGTTTTTTTTTTCTTTTTTGAGGAATTATCA
gggaagtgaggaaatgtttgggagaggactttctaagctctatttaggtgttagatctaa
ttacttatagattctgtagtctggtgaaggtgtgggtgacgtgatgagaggtttgagaaa
tgggtgaaatgaaatgggggatatgtaggtcaaatcaaattaaagatgatttttttaatg