Gene ODC1 Variant 1
DNA : 7.95 KbNT_005334
mRNA : 2062 bp NM_002539
CDS : 1386 bp NP_002530
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  207 bp
gctgacgtcggcccgccggcgccccaccagctccgcgcgggcccgggttggccaccgccg
ggcccccgcccctcccccggcggtgtcccggccggaaccgatcgtggctggtttgagctg
gtgcgtctccatggcgacccgccggtgctataagtagggagcggcgtgccgtggggcttt
GTCAGTCCCTCCTGTAGCCGCCGCCGCCGCCGCCCGCCGCCCCTCTGCCAGCAGCTCCGG
CGCCACCTCGGGCCGGCGTCTCCGGCGGGCGGGAGCCAGGCGCTGACGGGCGCGGCGGGG
GCGGCCGAGCGCTCCTGCGGCTGCGACTCAGGCTCCGGCGTCTGCGCTTCCCCATGGGGC
TGGCCTGCGGCGCCTGGGCGCTCTGAG
gtgagggactccccggccgcggaggaagggagggagcgagggcgggagccggggcgggct
gcgggccccgggccccgggcacgtgtgcggcgcgcctcgccggcctgcggagacacgtgg
tcgccgagcgggccacgaccttgaggcgccgcttcctcccggcccggggttctcccgcgg
EXON 2  110 bp
ccttatactgccaaggtttatggaatcatgtaccttatgcctagtaataattaggatgac
caggccagtgagtggttcatatccggggcatgattagctctgcgtgtgctcagccagtgc
cccatcttcaactcgatgtgttcctaaggtagacagcaaattccctattttatttctcag
ATTGTCACTGCTGTTCCAAGGGCACACGCAGAGGGATTTGGAATTCCTGGAGAGTTGCCT
TTGTGAGAAGCTGGAAATATTTCTTTCAATTCCATCTCTTAGTTTTCCAT
gtaagtattcagtttacatttatgttgcaggttaatcttaagaattgtattgctaaggct
tctaagtgaatttctccactctatttgcattttgttgcatttcagaggaacatcaagaaa
tcatgaacaactttggtaatgaagagtttgactgccacttcctcgatgaaggttttactg
EXON 3  119 bp
atttggaattcctggagagttgcctttgtgagaagctggaaatatttctttcaattccat
ctcttagttttccatgtaagtattcagtttacatttatgttgcaggttaatcttaagaat
tgtattgctaaggcttctaagtgaatttctccactctatttgcattttgttgcatttcag
AGGAACATCAAGAAATCATGAACAACTTTGGTAATGAAGAGTTTGACTGCCACTTCCTCG
ATGAAGGTTTTACTGCCAAGGACATTCTGGACCAGAAAATTAATGAAGTTTCTTCTTCT
gtaagtatatgaggcccatgctggcagtgcagctgagagtgccaggcaagtggaaaactt
tggcaaggtctaaggaagagcaatgaggcttacatgtcttgttatggaatgtagaaatta
attcactggtggtaaattaatagtgataatggtgatactcatatcagtggctagactcaa
EXON 4  174 bp
atggaatgtagaaattaattcactggtggtaaattaatagtgataatggtgatactcata
tcagtggctagactcaaaagagcaggattcattgtgactgatgggaatgaaggtcgctgg
ctattggtgtggtgtgtggtgaggctgctagtgagtcacctgtgaccactcttgtttcag
GATGATAAGGATGCCTTCTATGTGGCAGACCTGGGAGACATTCTAAAGAAACATCTGAGG
TGGTTAAAAGCTCTCCCTCGTGTCACCCCCTTTTATGCAGTCAAATGTAATGATAGCAAA
GCCATCGTGAAGACCCTTGCTGCTACCGGGACAGGATTTGACTGTGCTAGCAAG
gtaagcgatagcagcaggcctcaaaagcgttgtataaaatgggcctggtattccccacga
ggcagatacaagttgtgttttttgggcaataaatgctcactaaaggcaaatggggcgggg
gggtacatgacaacttcccatgcttttctgtttattccacgtgttaagccacatatggat
EXON 5  173 bp
gcgttgtataaaatgggcctggtattccccacgaggcagatacaagttgtgttttttggg
caataaatgctcactaaaggcaaatggggcgggggggtacatgacaacttcccatgcttt
tctgtttattccacgtgttaagccacatatggatagcatgacaccactcttctttttcag
ACTGAAATACAGTTGGTGCAGAGTCTGGGGGTGCCTCCAGAGAGGATTATCTATGCAAAT
CCTTGTAAACAAGTATCTCAAATTAAGTATGCTGCTAATAATGGAGTCCAGATGATGACT
TTTGATAGTGAAGTTGAGTTGATGAAAGTTGCCAGAGCACATCCCAAAGCAAA
gtgagttattcccccatctgagggcaagatcgggagcataagatatgtggattcttatca
aacaaacttaaatttctgattattatatttctatactttagtagaaagtagttgaaaccc
ccattgagtcatgaagcctgggactcaaactacagaatatatcagcgacagtatttagaa
EXON 6  135 bp
attattatatttctatactttagtagaaagtagttgaaacccccattgagtcatgaagcc
tgggactcaaactacagaatatatcagcgacagtatttagaacaggattgtttttatttt
aattgtggctataagtgaacatctatcatgagacatttgctgcactttccttgcttgtag
GTTGGTTTTGCGGATTGCCACTGATGATTCCAAAGCAGTCTGTCGTCTCAGTGTGAAATT
CGGTGCCACGCTCAGAACCAGCAGGCTCCTTTTGGAACGGGCGAAAGAGCTAAATATCGA
TGTTGTTGGTGTCAG
gtgagattttggtgggatagctagaggtcaagacattgaacagtttgagttttacaggct
ttctcctagtgtttgctattattttaagaaatactaagacacagtgtctcgtctctttat
tttaccccagcttccatgtaggaagcggctgtaccgatcctgagaccttcgtgcaggcaa
EXON 7  82 bp
ctccttttggaacgggcgaaagagctaaatatcgatgttgttggtgtcaggtgagatttt
ggtgggatagctagaggtcaagacattgaacagtttgagttttacaggctttctcctagt
gtttgctattattttaagaaatactaagacacagtgtctcgtctctttattttaccccag
CTTCCATGTAGGAAGCGGCTGTACCGATCCTGAGACCTTCGTGCAGGCAATCTCTGATGC
CCGCTGTGTTTTTGACATGGGG
gtgagtatacgtgaccctgttagggaagggcgggacacaactgacaataactagtcttaa
ttctagagttaactttttatggcagttggttctgtattacatgggtttcagcctatctgc
tgcatacatttttgttattagctgtggatctggctgacttattttcttgattctaggctg
EXON 8  84 bp
gggggtgagtatacgtgaccctgttagggaagggcgggacacaactgacaataactagtc
ttaattctagagttaactttttatggcagttggttctgtattacatgggtttcagcctat
ctgctgcatacatttttgttattagctgtggatctggctgacttattttcttgattctag
GCTGAGGTTGGTTTCAGCATGTATCTGCTTGATATTGGCGGTGGCTTTCCTGGATCTGAG
GATGTGAAACTTAAATTTGAAGAG
gtaatttagaacaaaactgtaatactcagtagccgttctaataaattcctttttggaata
tttcaaaatttaagtgtcttaactaataccacaatgggctgaagtgtcttggtgtgatat
tttgagtgatttctttgtgctgtctgacattacacttgataccatttggttttctaaagt
EXON 9  163 bp
gatatgtagcctggttttcagggagatgttgatgtttttttgcttttgttactttaatga
taaacctgtctgttgatgcctggtctcatgatgtcatgtcacaaggccctgtgatgttac
tcccccatgtgaatttcccacaatgaaggctgctctttcttttctgtttcactctcttag
ATCACCGGCGTAATCAACCCAGCGTTGGACAAATACTTTCCGTCAGACTCTGGAGTGAGA
ATCATAGCTGAGCCCGGCAGATACTATGTTGCATCAGCTTTCACGCTTGCAGTTAATATC
ATTGCCAAGAAAATTGTATTAAAGGAACAGACGGGCTCTGATG
gtatgtataaaggacgaatcacttcatgtataactgaaagctgatgcaaaaagtcattaa
gattgttgatctgcctttctagacgaagatgagtcgagtgagcagacctttatgtattat
gtgaatgatggcgtctatggatcatttaattgcatactctatgaccacgcacatgtaaag
EXON 10  113 bp
agctgagcccggcagatactatgttgcatcagctttcacgcttgcagttaatatcattgc
caagaaaattgtattaaaggaacagacgggctctgatggtatgtataaaggacgaatcac
ttcatgtataactgaaagctgatgcaaaaagtcattaagattgttgatctgcctttctag
ACGAAGATGAGTCGAGTGAGCAGACCTTTATGTATTATGTGAATGATGGCGTCTATGGAT
CATTTAATTGCATACTCTATGACCACGCACATGTAAAGCCCCTTCTGCAAAAG
gtaatttctgagcatactgtataaaacaattaagaggactggtcacaacacgtgtaatta
agtagtacttcctctctccgtctctttatatagagacctaaaccagatgagaagtattat
tcatccagcatatggggaccaacatgtgatggcctcgatcggattgttgagcgctgtgac
EXON 11  215 bp
tttatgtattatgtgaatgatggcgtctatggatcatttaattgcatactctatgaccac
gcacatgtaaagccccttctgcaaaaggtaatttctgagcatactgtataaaacaattaa
gaggactggtcacaacacgtgtaattaagtagtacttcctctctccgtctctttatatag
AGACCTAAACCAGATGAGAAGTATTATTCATCCAGCATATGGGGACCAACATGTGATGGC
CTCGATCGGATTGTTGAGCGCTGTGACCTGCCTGAAATGCATGTGGGTGATTGGATGCTC
TTTGAAAACATGGGCGCTTACACTGTTGCTGCTGCCTCTACGTTCAATGGCTTCCAGAGG
CCGACGATCTACTATGTGATGTCAGGGCCTGCGTG
gtaagtaagccatgcatgttgatggtgctgccaagaataggcaccttcttggatgtgtgc
ttcttgtctagacgaataagaaattgtcttgcctaagattaaatatatatggatattttt
cctaagaaaagttttagaaaagactgatgagtgtatttctatgtaattggaatatattta
EXON 12  487 bp
ggaggttgaggctgcggtgagctatgatagcaccattgtattccagcctgagtaacagag
aaagaccctgtctcagaaaaaaaaaaaatacattgaattgtttcctgatgggaagtaaat
actctcatgcccagttaggagtgagtcagggtttttaatatgccactttttctttctcag
GCAACTCATGCAGCAATTCCAGAACCCCGACTTCCCACCCGAAGTAGAGGAACAGGATGC
CAGCACCCTGCCTGTGTCTTGTGCCTGGGAGAGTGGGATGAAACGCCACAGAGCAGCCTG
TGCTTCGGCTAGTATTAATGTGTAGATAGCACTCTGGTAGCTGTTAACTGCAAGTTTAGC
TTGAATTAAGGGATTTGGGGGGACCATGTAACTTAATTACTGCTAGTTTTGAAATGTCTT
TGTAAGAGTAGGGTCGCCATGATGCAGCCATATGGAAGACTAGGATATGGGTCACACTTA
TCTGTGTTCCTATGGAAACTATTTGAATATTTGTTTTATATGGATTTTTATTCACTCTTC
AGACACGCTACTCAAGAGTGCCCCTCAGCTGCTGAACAAGCATTTGTAGCTTGTACAATG
GCAGAATGGGCCAAAAGCTTAGTGTTGTGACCTGTTTTTAAAATAAAGTATCTTGAAATA
ATTAGGC
attgggacgtttttatggtgtgttcattccagacagttcacgaatcccgtatagctcgct
ctgattctcagagaacaatgagtgggtccacccacacacaggtaggaggacaggtgagac
ggaagccccatcctcccatgtggacggtgcacatctgctcagcccaccccacatgtccag