Gene NR4A2 Variant 1
DNA : 8.25 KbNT_005403
mRNA : 3259 bp NM_173173
CDS : 1743 bp NP_775263
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  209 bp
gccctgctcgtgacgtcaggtcggaaatataccaaagcgagcgcgggccaggagtccagg
gagcgcggcagcgcggcgattgggcggcgggccgctgacgcgcgctgacgcgcggagact
ttaggtgcatgttggcagcggcagcgcaagccacataaacaaaggcacattggcggccag
GGCCAGTCCGCCCGGCGGCTCGCGCACGGCTCCGCGGTCCCTTTTGCCTGTCCAGCCGGC
CGCCTGTCCCTGCTCCCTCCCTCCGTGAGGTGTCCGGGTTCCCTTCGCCCAGCTCTCCCA
CCCCTACCCGACCCCGGCGCCCGGGCTCCCAGAGGGAACTGCACTTCGGCAGAGTTGAAT
GAATGAAGACAGACGCGGAGAACTCCTAA
gtgagtagatgcagcccatgcagttcgccttcttttatgctttttccttcttttgcacgt
ctcttctttccacttgtgtgggacaggttctctggaagtgggagccagaggcttctagtg
agagtgggaccgaaggatggggagtgcgtgcgcgcagttaccggggggcatttgttcgaa
EXON 2  124 bp
ttgtttcaagtcatttcttttatacattcattttaagtgctatgtttggtaaaggcttcc
cactcatttccaatgagacaaacagggaaggcatggaagggcctgcctggtgagtctaca
tatgcccagctgaatctctgtcgggaagaaaccctgaagcttcctgtgtctgtatttcag
GGAGGAGATTGGACAGGCTGGACTCCCCATTGCTTTTCTAAAAATCTTGGAAACTTTGTC
CTTCATTGAATTACGACACTGTCCACCTTTAATTTCCTCGAAAACGCCTGTAACTCGGCT
GAAG
gttagtgcaacttcatttctttcctttactctccagagctccccaaacatcaagaaacag
gacaaggcaaaccctgtaacttaaggtttgcccgacccatcgccttcgggaacaactttc
tcattgtgaaattcaacttcatttctagatggtcatttctagaaagagactgctgaatct
EXON 3  688 bp
agccatgccttgtgttcaggcgcagtatgggtcctcgcctcaaggagccagccccgcttc
tcagagctacagttaccactcttcgggagaatacagctccgatttcttaactccagagtt
tgtcaagtttagcatggacctcaccaacactgaaatcactgccaccacttctctccccag
CTTCAGTACCTTTATGGACAACTACAGCACAGGCTACGACGTCAAGCCACCTTGCTTGTA
CCAAATGCCCCTGTCCGGACAGCAGTCCTCCATTAAGGTAGAAGACATTCAGATGCACAA
CTACCAGCAACACAGCCACCTGCCCCCCCAGTCTGAGGAGATGATGCCGCACTCCGGGTC
GGTTTACTACAAGCCCTCCTCGCCCCCGACGCCCACCACCCCGGGCTTCCAGGTGCAGCA
CAGCCCCATGTGGGACGACCCGGGATCTCTCCACAACTTCCACCAGAACTACGTGGCCAC
TACGCACATGATCGAGCAGAGGAAAACGCCAGTCTCCCGCCTCTCCCTCTTCTCCTTTAA
GCAATCGCCCCCTGGCACCCCGGTGTCTAGTTGCCAGATGCGCTTCGACGGGCCCCTGCA
CGTCCCCATGAACCCGGAGCCCGCCGGCAGCCACCACGTGGTGGACGGGCAGACCTTCGC
TGTGCCCAACCCCATTCGCAAGCCCGCGTCCATGGGCTTCCCGGGCCTGCAGATCGGCCA
CGCGTCTCAGCTGCTCGACACGCAGGTGCCCTCACCGCCGTCGCGGGGCTCCCCCTCCAA
CGAGGGGCTGTGCGCTGTGTGTGGGGACAACGCGGCCTGCCAACACTACGGCGTGCGCAC
CTGTGAGGGCTGCAAAGGCTTCTTTAAG
gtgagcaatggcgggagcggagtaggcaggtagggagcccctagtgcccgggacctcgga
gtgtgccctctgccttggtgccagtagcccagccccagctctcccgggactgcccagctc
tccggggtccgccgaagctgccctgcaggagaccatgggctgcggcggggacttccgggt
EXON 4  130 bp
gggaggaaaaaagaaaagaaagaaagaaaaggaagagaaaaaaataaaatggaattgtgt
gtatgtgtttgtttgtggggaggaatcgtagaccccagtcacataacagaaattttctcc
gagttgcctgattttcaaaagaagaaaaaaaatgttggtctatattgtctccttttgcag
CGCACAGTGCAAAAAAATGCAAAATACGTGTGTTTAGCAAATAAAAACTGCCCAGTGGAC
AAGCGTCGCCGGAATCGCTGTCAGTACTGCCGATTTCAGAAGTGCCTGGCTGTTGGGATG
GTCAAAGAAG
gtaggctgaggggagctgccgaccctccagtttgcgcctttaggaaaccactgctcatac
tccagcatcacgttccacttcccggtgctggggatctccgactccccctcagtatggcct
ccaggaccctgcagctgcctgcttgcccggccttccctagagaaagccgccaggcccttc
EXON 5  164 bp
gaagacataaaataaccccgcattttttaatgcttctagtcagtgaaggctttacaagca
ctggggccctcagccgctcagcctggtgccccgcggctgcggccttccccggggagggac
cgaggcagcagctgggcctgggctcggaaaagcggcgctaacagggctcttcctttgcag
TGGTTCGCACAGACAGTTTAAAAGGCCGGAGAGGTCGTTTGCCCTCGAAACCGAAGAGCC
CACAGGAGCCCTCTCCCCCTTCGCCCCCGGTGAGTCTGATCAGTGCCCTCGTCAGGGCCC
ATGTCGACTCCAACCCGGCTATGACCAGCCTGGACTATTCCAGG
gtaagaagctggcgggggggatatcatgtggacaaaccgacagatgggcaggacccctcc
ccacatccgtcattaactctcagattcaacgggggtaaagaaggcaagcaaggctgtata
tgcctcgcagctctggccagggcctcaagattcagatcttcagacaatccatgtagctgg
EXON 6  203 bp
gacctcgtagcaccatccctaattgaattaattgccccggaacatctaatttccttactg
gtcagagagaggtttaattgttataaaaacctggctcccctattagaaacggggttagca
atttcacgggttatatattttagagaacctcattaagtgctttttaaaatgaaattccag
TTCCAGGCGAACCCTGACTATCAAATGAGTGGAGATGACACCCAGCATATCCAGCAATTC
TATGATCTCCTGACTGGCTCCATGGAGATCATCCGGGGCTGGGCAGAGAAGATCCCTGGC
TTCGCAGACCTGCCCAAAGCCGACCAAGACCTGCTTTTTGAATCAGCTTTCTTAGAACTG
TTTGTCCTTCGATTAGCATACAG
gtaataagggagggagggagacaatccagggaggctgtgagagaaatcaagaaaggaaaa
gaaagggaggaagggaaaccagagggtggggtagagaaaaagacagaataggaaatggaa
gtcggagaaaggaagaaaaagaaagaaaacaaaaaaagacgagaagaagcgagcccagaa
EXON 7  179 bp
agggggcgttcttgattgttatgaaattaaaccctttcaaggtccactggtctacatttt
attaactcttcagtaattaggtgactcttaaatccctcatttattgctcttcaagtaatt
agttgtttagcttttctctctctctttttctcccctctctctctttggtattaattgcag
GTCCAACCCAGTGGAGGGTAAACTCATCTTTTGCAATGGGGTGGTCTTGCACAGGTTGCA
ATGCGTTCGTGGCTTTGGGGAATGGATTGATTCCATTGTTGAATTCTCCTCCAACTTGCA
GAATATGAACATCGACATTTCTGCCTTCTCCTGCATTGCTGCCCTGGCTATGGTCACAG
gtcagtactgcaggcgcagggcgcttcccctccagaactgcctagcaggatttgtcctga
gtttcccttgtcacagattctccttggttttgccaactagctaactgtcttgtacattct
tcttttgtttctgattatgttttctgcagagagacacgggctcaaggaacccaagagagt
EXON 8  1562 bp
tcctgcattgctgccctggctatggtcacaggtcagtactgcaggcgcagggcgcttccc
ctccagaactgcctagcaggatttgtcctgagtttcccttgtcacagattctccttggtt
ttgccaactagctaactgtcttgtacattcttcttttgtttctgattatgttttctgcag
AGAGACACGGGCTCAAGGAACCCAAGAGAGTGGAAGAACTGCAAAACAAGATTGTAAATT
GTCTCAAAGACCACGTGACTTTCAACAATGGGGGGTTGAACCGCCCCAATTATTTGTCCA
AACTGTTGGGGAAGCTCCCAGAACTTCGTACCCTTTGCACACAGGGGCTACAGCGCATTT
TCTACCTGAAATTGGAAGACTTGGTGCCACCGCCAGCAATAATTGACAAACTTTTCCTGG
ACACTTTACCTTTCTAAGACCTCCTCCCAAGCACTTCAAAGGAACTGGAATGATAATGGA
AACTGTCAAGAGGGGGCAAGTCACATGGGCAGAGATAGCCGTGTGAGCAGTCTCAGCTCA
AGCTGCCCCCCATTTCTGTAACCCTCCTAGCCCCCTTGATCCCTAAAGAAAACAAACAAA
CAAACAAAAACTGTTGCTATTTCCTAACCTGCAGGCAGAACCTGAAAGGGCATTTTGGCT
CCGGGGCATCCTGGATTTAGAACATGGACTACACACAATACAGTGGTATAAACTTTTTAT
TCTCAGTTTAAAAATCAGTTTGTTGTTCAGAAGAAAGATTGCTATAATGTATAATGGGAA
ATGTTTGGCCATGCTTGGTTGTTGCAGTTCAGACAAATGTAACACACACACACATACACA
CACACACACACACACAGAGACACATCTTAAGGGGACCCACAAGTATTGCCCTTTAACAAG
ACTTCAAAGTTTTCTGCTGTAAAGAAAGCTGTAATATATAGTAAAACTAAATGTTGCGTG
GGTGGCATGAGTTGAAGAAGGCAAAGGCTTGTAAATTTACCCAATGCAGTTTGGCTTTTT
AAATTATTTTGTGCCTATTTATGAATAAATATTACAAATTCTAAAAGATAAGTGTGTTTG
CAAAAAAAAAGAAAATAAATACATAAAAAAGGGACAAGCATGTTGATTCTAGGTTGAAAA
TGTTATAGGCACTTGCTACTTCAGTAATGTCTATATTATATAAATAGTATTTCAGACACT
ATGTAGTCTGTTAGATTTTATAAAGATTGGTAGTTATCTGAGCTTAAACATTTTCTCAAT
TGTAAAATAGGTGGGCACAAGTATTACACATCAGAAAATCCTGACAAAAGGGACACATAG
TGTTTGTAACACCGTCCAACATTCCTTGTTTGTAAGTGTTGTATGTACCGTTGATGTTGA
TAAAAAGAAAGTTTATATCTTGATTATTTTGTTGTCTAAAGCTAAACAAAACTTGCATGC
AGCAGCTTTTGACTGTTTCCAGAGTGCTTATAATATACATAACTCCCTGGAAATAACTGA
GCACTTTGAATTTTTTTTATGTCTAAAATTGTCAGTTAATTTATTATTTTGTTTGAGTAA
GAATTTTAATATTGCCATATTCTGTAGTATTTTTCTTTGTATATTTCTAGTATGGCACAT
GATATGAGTCACTGCCTTTTTTTCTATGGTGTATGACAGTTAGAGATGCTGATTTTTTTT
CTGATAAATTCTTTCTTTGAGAAAGACAATTTTAATGTTTACAACAATAAACCATGTAAA
TG
aacagaattttgtcttctttttgggtcagaaaaaataatgactaaacagcaacataacat
acacagttggagattaatttgggataggtcacttattcaatatctgaattttaaacagcc
taaatctattctggcaaaagaaatcaggtgaaccagaataattatgcagataattcagta