Gene NFE2L2 Variant 1
DNA : 34.38 KbNT_005403
mRNA : 2405 bp NM_006164
CDS : 1818 bp NP_006155
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  158 bp
ttcttgcgtcagccccggcgcgggtgggggattttcggaagctcagcccgcgcggccggc
gggggaaggaagggcccggactcttgccccgcccttgtggggcgggaggcggagcggggc
aggggcccgccggcgtgtagccgattaccgagtgccggggagcccggaggagccgccgac
GCAGCCGCCACCGCCGCCGCCGCCGCCACCAGAGCCGCCCTGTCCGCGCCGCGCCTCGGC
AGCCGGAACAGGGCCGCCGTCGGGGAGCCCCAACACACGGTCCACAGCTCATCATGATGG
ACTTGGAGCTGCCGCCGCCGGGACTCCCGTCCCAGCAG
gtgctgcctcggccctctgggccctgcggtggtgccgggacgggggcgggggagctaggg
aaccgcggcccgggagggacagccgcaaccggcttcccccacgtctggccagagccagga
ccgcggcgctgggtagagccgccgcgcttgcgccggggcagggcggggaggggcagcggg
EXON 2  267 bp
attcattgaatggaattaactgtgctcttctagaacattggatctgtgttctcatttaga
ttgtatttgtaatctccccacttcccaccatcaacagtggcataatgtgaattaatttat
gtggtatctgtcatttaaaaaacatgagctctctccttcctttttttgtcttaaacatag
GACATGGATTTGATTGACATACTTTGGAGGCAAGATATAGATCTTGGAGTAAGTCGAGAA
GTATTTGACTTCAGTCAGCGACGGAAAGAGTATGAGCTGGAAAAACAGAAAAAACTTGAA
AAGGAAAGACAAGAACAACTCCAAAAGGAGCAAGAGAAAGCCTTTTTCGCTCAGTTACAA
CTAGATGAAGAGACAGGTGAATTTCTCCCAATTCAGCCAGCCCAGCACATCCAGTCAGAA
ACCAGTGGATCTGCCAACTACTCCCAG
gtacagagtactcagttcttgggaaagttatggcaggtttaaggaaacactgagcaagga
attaaaatatctggatttgagttccagctttgcctttcttttacttaaccttgtcaaatc
tactttccaacctcagcctcctgatgagttcagtacctaacctgagttcagtacccaacc
EXON 3  90 bp
gctaagatctgaacccatgtggtctagttcaaattgtgcatcaaagtgatctctgaaata
agataaatatttacttaacttgattataaatattttatgaacatcaattattgaatattt
agcttggcaatggaatatttaaccatttttgttttcctttgtgtcattcccttttatcag
GTTGCCCACATTCCCAAATCAGATGCTTTGTACTTTGATGACTGCATGCAGCTTTTGGCG
CAGACATTCCCGTTTGTAGATGACAATGAG
gtgaggtataaaataacctggttaatagaaaaactccatcataactataaaataacaatc
tattctatgtaagtcccgtcaatgaatctccatttaaaagaataaaaacatttttaggag
gaaattttttaaccaaggaaatactcttgtcaaggaaaccttagcctataaataacttta
EXON 4  192 bp
aaatttgagtcagtggggtaggaaaaaaagatttgttatttacaaacggggtcatgactg
gttagtaagtagagagacacagaactgcagctgattccattttgttttgtagtggtgcct
tagagcttactcatcccctgttggtggaagactcataaatcaatgccttatcaattttag
GTTTCTTCGGCTACGTTTCAGTCACTTGTTCCTGATATTCCCGGTCACATCGAGAGCCCA
GTCTTCATTGCTACTAATCAGGCTCAGTCACCTGAAACTTCTGTTGCTCAGGTAGCCCCT
GTTGATTTAGACGGTATGCAACAGGACATTGAGCAAGTTTGGGAGGAGCTATTATCCATT
CCTGAGTTACAG
gtaactaaaatagaatgtaatactggagattttttttatattcagtgcctttagtcattc
tgattatttatataccacctatttataggaaggattggagggtgctattaacttagtcat
gagtactgcccatgctagttaaattggttggacatcttgaggatagaatgttataaacct
EXON 5  1698 bp
aaataatacataacgcttaggcgtaaatatgtattggaaatgagaattatctctgaatta
tagataataaattatagagataagcctgaagataatgtgggtagggagtttatctaaatt
tatcacgtattatcatggattaactttgatttatatagtataaacttccttctcatgcag
TGTCTTAATATTGAAAATGACAAGCTGGTTGAGACTACCATGGTTCCAAGTCCAGAAGCC
AAACTGACAGAAGTTGACAATTATCATTTTTACTCATCTATACCCTCAATGGAAAAAGAA
GTAGGTAACTGTAGTCCACATTTTCTTAATGCTTTTGAGGATTCCTTCAGCAGCATCCTC
TCCACAGAAGACCCCAACCAGTTGACAGTGAACTCATTAAATTCAGATGCCACAGTCAAC
ACAGATTTTGGTGATGAATTTTATTCTGCTTTCATAGCTGAGCCCAGTATCAGCAACAGC
ATGCCCTCACCTGCTACTTTAAGCCATTCACTCTCTGAACTTCTAAATGGGCCCATTGAT
GTTTCTGATCTATCACTTTGCAAAGCTTTCAACCAAAACCACCCTGAAAGCACAGCAGAA
TTCAATGATTCTGACTCCGGCATTTCACTAAACACAAGTCCCAGTGTGGCATCACCAGAA
CACTCAGTGGAATCTTCCAGCTATGGAGACACACTACTTGGCCTCAGTGATTCTGAAGTG
GAAGAGCTAGATAGTGCCCCTGGAAGTGTCAAACAGAATGGTCCTAAAACACCAGTACAT
TCTTCTGGGGATATGGTACAACCCTTGTCACCATCTCAGGGGCAGAGCACTCACGTGCAT
GATGCCCAATGTGAGAACACACCAGAGAAAGAATTGCCTGTAAGTCCTGGTCATCGGAAA
ACCCCATTCACAAAAGACAAACATTCAAGCCGCTTGGAGGCTCATCTCACAAGAGATGAA
CTTAGGGCAAAAGCTCTCCATATCCCATTCCCTGTAGAAAAAATCATTAACCTCCCTGTT
GTTGACTTCAACGAAATGATGTCCAAAGAGCAGTTCAATGAAGCTCAACTTGCATTAATT
CGGGATATACGTAGGAGGGGTAAGAATAAAGTGGCTGCTCAGAATTGCAGAAAAAGAAAA
CTGGAAAATATAGTAGAACTAGAGCAAGATTTAGATCATTTGAAAGATGAAAAAGAAAAA
TTGCTCAAAGAAAAAGGAGAAAATGACAAAAGCCTTCACCTACTGAAAAAACAACTCAGC
ACCTTATATCTCGAAGTTTTCAGCATGCTACGTGATGAAGATGGAAAACCTTATTCTCCT
AGTGAATACTCCCTGCAGCAAACAAGAGATGGCAATGTTTTCCTTGTTCCCAAAAGTAAG
AAGCCAGATGTTAAGAAAAACTAGATTTAGGAGGATTTGACCTTTTCTGAGCTAGTTTTT
TTGTACTATTATACTAAAAGCTCCTACTGTGATGTGAAATGCTCATACTTTATAAGTAAT
TCTATGCAAAATCATAGCCAAAACTAGTATAGAAAATAATACGAAACTTTAAAAAGCATT
GGAGTGTCAGTATGTTGAATCAGTAGTTTCACTTTAACTGTAAACAATTTCTTAGGACAC
CATTTGGGCTAGTTTCTGTGTAAGTGTAAATACTACAAAAACTTATTTATACTGTTCTTA
TGTCATTTGTTATATTCATAGATTTATATGATGATATGACATCTGGCTAAAAAGAAATTA
TTGCAAAACTAACCACTATGTACTTTTTTATAAATACTGTATGGACAAAAAATGGCATTT
TTTATATTAAATTGTTTAGCTCTGGCAAAAAAAAAAAATTTTAAGAGCTGGTACTAATAA
AGGATTATTATGACTGTT
aaattatttgtttgggattcctttgagtttattcacacagtattttccataagataatca
tccatttaatttagatgttttgcattttcagaatgttttatttgaaaatataaaaataat
tttatactacatttctagtaccagggttacagagaaataaagtatatcaagaggatactt