Gene MRPS5 Variant 1
DNA : 34.80 KbNT_026970
mRNA : 1655 bp NM_031902
CDS : 1293 bp NP_114108
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  271 bp
gggtccgcagtgccagctcgggtaagtccgagggtcccccgccagcggaccccttcagag
ctcctgcacgagcagccaaatccacccggccggtcctgccctctctccggcgctgcagga
gccagctagccccgcccacgcccggccgccagtccaagccccgccctcgggtcctaacgg
GAGGCGCCCGCGGGGCTGTCCGCGGTCGCGCCGGGCTCCGCCTGCAGTGTGGCCCGTCCG
GACAGTCCCTCACCCCGGCCTGCGCTGCTGCGTGGACTCGGGCCTCAGGAATTCCGCTGC
GGCCCAAGGCTTGCCGTTTGACGAGGAGCAGTCGCGGTAGGCGGTGGGCAAGGCTGCCCT
GGGCGGAGGCCGAGGCGCGGCTCGGACTCCAGCATGGCGACCGCGGTGCGCGCTGTGGGC
TGCCTCCCCGTGCTGTGTAGCGGGACGGCAG
gtgagagctgggacgccgggagcaggggctctgagcgggccgggagtggggggctcgcct
ggggcctgcagaagtcggggcggagggaagcgagaagccgcggcccccggctcttcacgc
cgtgcccccaccttccgccggagccgctgtgtgaccttgcgcgcgtcctctccctctctg
EXON 2  81 bp
gggtgaagggagaagatgaggtatggtgtcagctacttgacaagttgtcctggagcccag
aaattacttactccctcgtcttggttctttattctatagatatattttgtgggtgttact
gtttaaaatgttcctttaatgtagaaatgtatcttaaatttttttttttccaatttgcag
GTCATTTATTGGGGAGGCAGTGTTCCCTAAACACCTTACCAGCAGCTTCCATTTTGGCAT
GGAAGAGTGTTCTCGGCAATG
gtgagattcattaatgctactaccttttctcataagatctaatgtcaaagtagtttctgt
agttttaaaaaatataagtaatcacctgcttttttcttttctctcttttcttttttcatt
ttttagcctggttagtcttactgcaataatcacattctttatgatgcgattacataggtt
EXON 3  138 bp
ggcatttaggttgttattgatcaaaagttttatttttaaaagaaagactcctaaaaatct
gattcttaaaagttcaggattttagtgacttatttttgttagtaatgattatttgatgct
agcagtgtttttccacagctgtgaaacatctaactcaaagtttaacccatctgcctacag
GCCATTTGTCATCACTGGGAACCAGAGACACCCATCCCTACGCCAGCTTGAGCCGTGCAC
TGCAGACACAATGCTGTATTTCTTCTCCCAGTCACCTGATGAGCCAGCAGTATAGACCAT
ATAGTTTCTTCACTAAAT
gtatgtagaatggccacaaacttcctgtttcttgaaacaggaaaaggatttcttatatct
gaatttttcttcttttttacatgaattaagattttagtgattagtttacaatgtactgtt
aaaatgaaaatgttccttgatgtacatcctagaattatctcacatgctaccagttgtatt
EXON 4  126 bp
ggctttccaagtgtaaccgtctgatgtgtgcaaaggatgatttaattttgctttcattac
ctcagtgatgcatgggtaaagctgtaagctgacctccacttctcttattattcaatagga
gatcatagaccattgcttgaaaactacagaattaagaaaagaaaccctgtttcgttacag
TGACTGCAGATGAGCTGTGGAAAGGCGCTTTAGCAGAGACTGGTGCTGGAGCAAAAAAAG
GAAGAGGCAAAAGAACTAAAAAGAAGAAAAGAAAGGATCTGAACAGGGGTCAGATCATTG
GTGAAG
gtaaacttatttataaaaatagctaaagtgctttgtaagtttcttaccccagattttata
gatattttacaaactagaagcatcaaaacatttcttatgaagggcactacgatctatggt
tttagaattcaaccagttgacttactcattgccccaggattctgggggaggaaaatccca
EXON 5  234 bp
taataccatgaagtatatttaaaattttgattgtgccaagtgacctaccaagttaataat
gttagcttaagctccagtgaacagtgtgtcatcattatctgtacatgcattgcctgacat
tttaacacttgaaaaatgagtactttaacaaaattattatttatatttttaaaccttcag
GGCGTTATGGTTTTCTATGGCCCGGACTGAATGTCCCTCTTATGAAAAATGGAGCAGTGC
AGACCATTGCCCAAAGAAGCAAGGAAGAGCAGGAGAAGGTGGAGGCAGACATGATCCAGC
AGAGAGAAGAGTGGGACCGAAAGAAGAAGATGAAGGTTAAACGGGAGCGAGGATGGAGTG
GAAACTCATGGGGAGGCATCAGTCTTGGCCCCCCTGACCCTGGTCCCTGTGGAG
gtagcaaactcctggttttgtttgcctttgtgacagagagtacttgtagtttagaatttc
cttgaaatggtgttattacttgtctgtttatactacctttttccaaaaaagatttgaaca
tctttgaaataacatatcacatcaatatcccaactgtattttgtggagtgcagaagtatt
EXON 6  35 bp
taactggtggagcagtctctagtgatgaggggtgactggggcatggccttgagagtggga
ccaaaagatctgagattctttctccccgaaaggtctgtgatggtgcctgtgttgaaaatg
ctttcatgttaattgtgtacacacatttcatctgtatccctgtttcttttctccctacag
AAACATATGAGGATTTTGATACCAGGATACTTGAG
gtaggcatgcagaattaaatacctggttaagcctttggagaggttggggtgggtggggca
gggacagggcaagaggaactgtaagggaaggccttggatgcatgactatttctgacacac
agctgatctgcgtaaggaaaattgtgcaactttaatttcagttactggatactggctctt
EXON 7  91 bp
tccaggaggaggttttgtttggaaaaaggctgttacttgtgctcaggagttggaggatgg
tgtgcctgttctctgtgtgtgcctgttcaccgtgtatgcctgcaaggaaggcggctccct
ccagttccctccttcagattttcttaatgtgcaatatttatgagacattttgccttttag
GTAAGAAACGTTTTCACTATGACTGCGAAAGAGGGAAGAAAGAAATCGATCCGTGTCTTG
GTGGCTGTGGGGAACGGAAAAGGAGCTGCAG
gtgaatggggagtgatggcatcacagtggcggtggtgtgcagggaaaggcgtggcacggg
ccatgctgtggagcccatgggctcatgctgctggccggactttttccattgattaaacct
tttagtggtttgggttcacaaagcttgtggtaagtccatgacttcccttagagagaaaag
EXON 8  47 bp
gagattacggatgtgaatcattacacccagcctattaatggttttgtatagcaagtcttt
tgtgggtggtggaaagatgaagtgctgtgaaatattgtaggagcagaaacttgaaatgtg
gcaaaaaccacatgggcaaaatttctgtctcttttcttatttttgcttttttgtttaaag
GTTTTTCTATTGGGAAAGCTACTGATCGGATGGATGCTTTCAGGAAA
gtatgtacattttttttctttgttgacactcagtaaaagattagtaagttatatgccaga
cacagtgggaaccacaaaacaataataatttgtcccagaaccttcccatgaggcttgctg
tcaagggttaattagctcataaaaatcagtttcagaagtacttatattcctttgcaccat
EXON 9  58 bp
tgatagtgatattgtagttaagagttttaaaaaataagtccttatattttagaagtatat
actaacctttttgcgtaagtgaatttttgataatgaaacatttttattaaaagtgttttt
ggaatccttgaaaagatgtaaatttcaacaatagagttaagaaaaacattttcctttcag
GCAAAGAACAGAGCAGTTCACCATTTGCATTATATAGAACGATATGAAGACCATACAA
gtgagtgataatctatttttttttttttaatttgcaggattacatttgttaaagtctgtg
tgacaatgtatctctataggtatctttgtgtttctctcttattacattcttacaaatata
tgaagtgtgaaaacaaatctcctaagaaggttactaaaatgaatgaaatcagagcttacc
EXON 10  63 bp
tgaagtgtgaaaacaaatctcctaagaaggttactaaaatgaatgaaatcagagcttacc
atttatctttggtcaatatgtgctggctgttgaggctagtatacattgctttgtgatatt
tgcaaaggcttattaaagccacacacctaatcctcttgtgtttatgtttttaccctccag
TATTCCATGATATTTCATTAAGATTTAAAAGGACGCATATCAAGATGAAGAAACAACCCA
AAG
gtaactttaaaactcttaccatttgttgatgataaagcagagaaattataacagttctat
cctctcctctatttttgttcatctttagttgaactcatcttggaaacaccaaaatgtaaa
aggcttatgttagatttaagaacgatgaggctcttggagaaataagaatagtcaaggcac
EXON 11  137 bp
agtaagtgtcatcttggaagttaagtaagttgtcaagggtcagctcactaggaagtggtg
ataccagaatatgaaccagtttcccgaagcccagagcctgaagccatgcgaaagccagca
gggtgactcctccggctgcaggcgagtgggctgtgtttcacccggtttctccttttctag
GTTACGGCCTCCGCTGCCACAGGGCCATCATCACCATCTGCCGGCTCATTGGCATCAAAG
ACATGTATGCCAAGGTCTCTGGGTCCATTAATATGCTCAGCCTCACCCAGGGCCTCTTCC
GTGGGCTCTCCAGACAG
gtaatcctttcccggggtctgaaacagaggttctagtttgtatttcagttgtgtgtgttg
gggctacgatgccctggggcctcctggagatgctttcctggggccacctgaggagttggg
cattctttgttgtctgtgactgcatcagtttagttaaatccattgacaagttcatgaaaa
EXON 12  374 bp
ctgaaatgactccacccatgacaggttattagagtttagccacaaaacacattaacccaa
atccactgaaatggcctttgaatacccccaggctgtactgttgtggcctgtggaagttcc
tgctctttatgttgcaaatgtacttcagacctaacctgttctgaatttggtcttgcttag
GAAACCCATCAACAGCTGGCTGATAAGAAGGGCCTCCATGTTGTGGAAATCCGGGAGGAA
TGTGGCCCTCTGCCCATTGTGGTTGCGTCCCCCCGGGGGCCCTTGAGGAAGGATCCAGAG
CCAGAAGATGAGGTTCCAGACGTCAAACTGGACTGGGAAGATGTGAAGACTGCACAGGGA
ATGAAGCGCTCTGTGTGGTCTAATTTGAAGAGAGCCGCCACGTAACCTCTCTGGCCTTGT
GCAGCCAGTTCCTGTGCTGCCCTGCACCTAGGAGAGACTCAGCCCCTCACAGCTTGGGAT
GTTACCTTGCCTTTTGTTTGTTTTGAGGGAAGTTTAATCTTTAAACTCTTTGGAAATAAA
TAATTATAGCTTTC
atttgttgagcacatgttatatgccaatgtgatagaacctttacatacatatctcagttc
aagactactttaaatattcatccaaagtaacaaaagtaaatgaattagggagacggggtt
aataatttgacccaatcagtaataatgtacacaatgataattgctgtagtaattatagct