Gene MRPL35 Variant 2
DNA : 13.39 KbNT_022184
mRNA : 967 bp NM_145644
CDS : 512 bp NP_663619
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  77 bp
aagaattttttttaataagaaattttgtagaaccttctataggcagtcgttttacagcgg
cgaagaacggaacccggcagatgacattgaataaatgttgagtggacaactttgttcttt
tcctcttccttgactccgcctccttgctttcccttcattctcttttgctcttgtgctttt
AAACCCAAAGCGGCCGCCGTAGGCGAAGGTGAAGATGGCTGCCTCTGCCTTTGCTGGTGC
AGTGAGAGCAGCTTCAG
gtcagtggagagcgacatactccatgcatgccttcacagaaggggaaactggtgcgggat
ggaatgggcgtttagactggaggttaacaagcaaaaagggtcattatttaagttaagaag
gttgcgcccaattttctctggggcggtgtgaccggcagcccgtaccaagtcccccgactc
EXON 2  190 bp
taaaatcagtaattaatttatggttataccttagtaaggtggtaaaagcttcacagatga
gtctgatgctcagggcacgttaattatgtttaatacttggtggcagtgatacatctctta
atttttaatatctggatgcatattttggagtattaaatatatatgctcctatctttacag
GAATCCTACGGCCCCTGAATATTTTGGCATCTTCAACCTACCGCAACTGTGTCAAGAATG
CCTCTCTTATTTCTGCATTGTCCACTGGACGTTTTAGTCATATTCAGACACCAGTTGTTT
CCTCCACTCCCAGACTTACCACATCTGAGAGAAACCTGACATGTGGGCATACCTCAGTGA
TCCTTAATAG
gtagagtatatttctttgtggggttttttttgttttttgttttttgtttttttttgagac
ggagtctcactctgttgcccaggccagagtgcagtggtgcattctcagctcactgcaacc
tccacctccggggttcaagcaattctcctgcctcagcctcctaagtagctggaaagttct
EXON 3  145 bp
ttggtgatggttgctattctaatttatgcttaatgtcatgggtcattggaagtaatattg
tatatgaaaagttagttccagtccattggagcagctttactcatttctcagtatagataa
tgaattttaatcctttaatcagtctgattacaagctaaaaattttaaaatatatttttag
AATGGCCCCCGTGCTTCCAAGTGTCCTGAAGCTGCCAGTCAGATCTCTAACATACTTCAG
TGCAAGAAAAGGCAAGAGAAAGACCGTGAAAGCTGTCATCGATAGGTTTCTTCGACTTCA
TTGTGGCCTTTGGGTGAGGAGAAAG
gtgagtcttcacactgttactaaattgaaaaaggaatgtgaggccgggcgtggtggctca
cgcctataatcccagcactttggcgggtggatcataaggtcaggagttcaagaccagctt
ggccaacatggtgaaactccatctctactaaaaatacaaaaattaggcgtggtggcaggc
EXON 4  134 bp
ccccctccccgccaccctcccttcccccggccattgagaatcacatctttccaagaaata
gtccagcccctatggaagtctggtttttgttcttattgggtctataaaccttgagttgtg
aagatacctgttgtttcatacatagtatgatgttttacatttctttgtaatatctgacag
GCTGGCTATAAGAAAAAATTATGGAAAAAGACACCTGCAAGGAAGAAGCGATTGAGGGAA
TTTGTATTCTGCAATAAAACCCAGAGTAAACTCTTAGATAAAATGACGACGTCCTTCTGG
AAGAGGCGAAACTG
gtacgttgatgatccttatcagaagtatcatgatcgaacaaacctgaaagtatagatcag
aagtttcacttgtttctcagttattggatatgtatctttgtgtacatatctttgcaaaaa
tggataagtacaaaacttgatgtaaattgtaccaatgaatacgtaaacatacagtgacaa
EXON 5  421 bp
gtgtgtttattaaaaggagaaaggataacaatagaatgttctaaaaccagaagtccaagt
gcgtgtctacttatgggaccaataaataaagaacagacatttgatttgaggtgaggtaaa
agcctgaaacatggaatggcattctgttttgatggattttcatttcttcgcacttctgag
ACGGCAAAGCCAACCACTTAGAAGCCTTCCACATCTTTGTCACCTGCCTGGCTCCTGCTC
TCTGATGTACCTCTGGGTAGTGAGATGGAAATGGTGCCTGCAGAAGTTGGGGAGAAGGAT
ACTTTTGCACAGCCTCCATGATGTCTTTATTGCAAATATGGATGACAAGGGTCTCTGTTA
CAGGGGCCTCAGAGCACCTTCGTTTCTCCTCTAGACCAGGGACAGGTGTAGAGATAAGGA
CTGGCAACCAGAGCCTCAGCATCCAAAGATGGACTGAAGTGGGATGGCTGACAGGCACAT
AACTTACGGGAAAGGGAATTTCATACATACGATTTTTGTTTTGTGGGTAGGAGGGCTTAT
CATCAACACTGATTTTATAATCTGACAATAAATGTCTTTCATTAAAGAGTTTACCTAAAT
G
atgttcgattatatgtataatttataaaatatttatgtatagtttgtttattcaggtata
tgtataatttattgaacacctactatgtcccagcatatctacaaaactgggtacatacat
actgtctaactgctaatccacatttccagtcttacaaaggacataatgattagttaagcc