Gene MRPL35 Variant 1
DNA : 13.39 KbNT_022184
mRNA : 2779 bp NM_016622
CDS : 567 bp NP_057706
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  77 bp
aagaattttttttaataagaaattttgtagaaccttctataggcagtcgttttacagcgg
cgaagaacggaacccggcagatgacattgaataaatgttgagtggacaactttgttcttt
tcctcttccttgactccgcctccttgctttcccttcattctcttttgctcttgtgctttt
AAACCCAAAGCGGCCGCCGTAGGCGAAGGTGAAGATGGCTGCCTCTGCCTTTGCTGGTGC
AGTGAGAGCAGCTTCAG
gtcagtggagagcgacatactccatgcatgccttcacagaaggggaaactggtgcgggat
ggaatgggcgtttagactggaggttaacaagcaaaaagggtcattatttaagttaagaag
gttgcgcccaattttctctggggcggtgtgaccggcagcccgtaccaagtcccccgactc
EXON 2  190 bp
taaaatcagtaattaatttatggttataccttagtaaggtggtaaaagcttcacagatga
gtctgatgctcagggcacgttaattatgtttaatacttggtggcagtgatacatctctta
atttttaatatctggatgcatattttggagtattaaatatatatgctcctatctttacag
GAATCCTACGGCCCCTGAATATTTTGGCATCTTCAACCTACCGCAACTGTGTCAAGAATG
CCTCTCTTATTTCTGCATTGTCCACTGGACGTTTTAGTCATATTCAGACACCAGTTGTTT
CCTCCACTCCCAGACTTACCACATCTGAGAGAAACCTGACATGTGGGCATACCTCAGTGA
TCCTTAATAG
gtagagtatatttctttgtggggttttttttgttttttgttttttgtttttttttgagac
ggagtctcactctgttgcccaggccagagtgcagtggtgcattctcagctcactgcaacc
tccacctccggggttcaagcaattctcctgcctcagcctcctaagtagctggaaagttct
EXON 3  145 bp
ttggtgatggttgctattctaatttatgcttaatgtcatgggtcattggaagtaatattg
tatatgaaaagttagttccagtccattggagcagctttactcatttctcagtatagataa
tgaattttaatcctttaatcagtctgattacaagctaaaaattttaaaatatatttttag
AATGGCCCCCGTGCTTCCAAGTGTCCTGAAGCTGCCAGTCAGATCTCTAACATACTTCAG
TGCAAGAAAAGGCAAGAGAAAGACCGTGAAAGCTGTCATCGATAGGTTTCTTCGACTTCA
TTGTGGCCTTTGGGTGAGGAGAAAG
gtgagtcttcacactgttactaaattgaaaaaggaatgtgaggccgggcgtggtggctca
cgcctataatcccagcactttggcgggtggatcataaggtcaggagttcaagaccagctt
ggccaacatggtgaaactccatctctactaaaaatacaaaaattaggcgtggtggcaggc
EXON 4  2367 bp
ccccctccccgccaccctcccttcccccggccattgagaatcacatctttccaagaaata
gtccagcccctatggaagtctggtttttgttcttattgggtctataaaccttgagttgtg
aagatacctgttgtttcatacatagtatgatgttttacatttctttgtaatatctgacag
GCTGGCTATAAGAAAAAATTATGGAAAAAGACACCTGCAAGGAAGAAGCGATTGAGGGAA
TTTGTATTCTGCAATAAAACCCAGAGTAAACTCTTAGATAAAATGACGACGTCCTTCTGG
AAGAGGCGAAACTGGTACGTTGATGATCCTTATCAGAAGTATCATGATCGAACAAACCTG
AAAGTATAGATCAGAAGTTTCACTTGTTTCTCAGTTATTGGATATGTATCTTTGTGTACA
TATCTTTGCAAAAATGGATAAGTACAAAACTTGATGTAAATTGTACCAATGAATACGTAA
ACATACAGTGACAACATTAAACTTAGAAAAGTTTTAAAACTTAATGGATCAGACTTTGCC
AGATTTGGTTAGGGAAACAGAAATTTAGAATGGTGCATTATTTTTAACAAATGGTATTGG
CTTAACTAGTTGTTTCAGTTATGCTCTTTTAGTTGCAAGGAATCTCAAGTGGGACAAACA
TAAAAAGACTCAAAAGCTACAAGTTAGCTCAAGCAATGTGACATTATTTCAAGGATATGT
GCCAGGGAATTCAGGAACCACCTCACCAACCCCATCTCCCACTCAGAAATCACCTCCCAG
CCTCAGGAAGAGTAGAAATTGGGTGGTGCTCCTCAGCAGGGGAAGGTGGATGTTTAGGCT
TGGGCTCTGCATGCATGTGACTTGCTTCTTTTTGCATTGTTAACTCCATTCTCTCTATTC
ACCAACTTCTCTACACAGCTTTTGCATACTTACAGTTTCTGTTCCTTTGTAATAACTTTA
ACTTGCACCTTTGAGGTTCTTTTCTACATGATGACCTTCAGCTCCTGCTGCTAGTCTCCA
ATTGCCAAGGGAATTTAACTGGGCCAGACTACCTTTTTATACTAGGTCTGGTTGGGTCAT
TGTCTAGAGTAGGGATTGGCTGTCCTTAAGTCAGGAGCCCGCTTTGTATTAGCAGGTTTG
CATGCAGCAAAAAAACAGTTATGTGAGCAGTTTCACTTGGAGGTTCACATGGGGTGGCAG
CACACTTAACATCTAACACACCAGGTTCATTGTGTTCATAACACTTGTCATTTACTGTAA
CAACATTTTTTCATAGGAGAGTAAATAGCCCTTCAGCATGCTCATTCATGAAACAGAAGA
GGCTGTACAAGTGAAGACAAGGGCTTTTTATGCAAGTTTTGAAAGATAGGTATTTATTTT
TTCTAGAGACAGGAGTTTTGCTCTGTTGCCCAGGCTGGAGTGCAGTGGTGCAATCATAGC
TCATTGAAGCCTCGCACTCCTGGGCTCAAGTGGTCCTCCTGCCTCAGCTTACTGAGTAAG
GATATGTATTTCTTAAAAGTTAGTTTATCCACTTCAGATTTCATGTTTTCATTTGTAAGG
ATAAACTTTTCCCACAAATTTTCAACAATCATTGTAGAAACTAAGGGGGAGAAAGTAATC
TCAGTTGTTTTAGAAACGAAAAAGTTAAGCATTGTTTACTTGAAGTGGGCAGGGAAGCAG
CACTGAGTAAAGTTCAATTGAGTGGTTACAGTCTAGGGCAGTGGTTCCCAACTCTCCGAT
CAGAATCATCTGGGAAGCATTTTCAAACAGCAAAGTACTTTGAAAACCATTATTAAATAG
AATTATGCATGAATTACTGTTTCAGATCCTTTAATGTGGTAGTTGGTAATAATAAGATGA
AATTCCTCTGTTGTTAGTAAAATTATGAAATTGAAGTTCTGCAGCATGTCAGGCCAGGAT
TATTAGGGAGATTCCTCGAAACTAGTGTGTGTTTATTAAAAGGAGAAAGGATAACAATAG
AATGTTCTAAAACCAGAAGTCCAAGTGCGTGTCTACTTATGGGACCAATAAATAAAGAAC
AGACATTTGATTTGAGGTGAGGTAAAAGCCTGAAACATGGAATGGCATTCTGTTTTGATG
GATTTTCATTTCTTCGCACTTCTGAGACGGCAAAGCCAACCACTTAGAAGCCTTCCACAT
CTTTGTCACCTGCCTGGCTCCTGCTCTCTGATGTACCTCTGGGTAGTGAGATGGAAATGG
TGCCTGCAGAAGTTGGGGAGAAGGATACTTTTGCACAGCCTCCATGATGTCTTTATTGCA
AATATGGATGACAAGGGTCTCTGTTACAGGGGCCTCAGAGCACCTTCGTTTCTCCTCTAG
ACCAGGGACAGGTGTAGAGATAAGGACTGGCAACCAGAGCCTCAGCATCCAAAGATGGAC
TGAAGTGGGATGGCTGACAGGCACATAACTTACGGGAAAGGGAATTTCATACATACGATT
TTTGTTTTGTGGGTAGGAGGGCTTATCATCAACACTGATTTTATAATCTGACAATAAATG
TCTTTCATTAAAGAGTTTACCTAAATG
atgttcgattatatgtataatttataaaatatttatgtatagtttgtttattcaggtata
tgtataatttattgaacacctactatgtcccagcatatctacaaaactgggtacatacat
actgtctaactgctaatccacatttccagtcttacaaaggacataatgattagttaagcc