Gene MARCO Variant 1
DNA : 52.49 KbNT_022135
mRNA : 1830 bp NM_006770
CDS : 1563 bp NP_006761
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  229 bp
tctcagggacctgggagtgacgggtgcattcagaggcccgtaacttgtgtcccaaagcct
cctcgatcccccttaacaagcagcagcactgtgtgggagatccacatgtgaatagcccgt
gtttgagaaatgtccaatcctgatcatgtcaggaaacatcctgcaaattctgaaatcaga
GCCAAAGGGAAGTGCTGCGAGGTTTACAACCAGCTGCAGTGGTTCGATGGGAAGGATCTT
TCTCCAAGTGGTTCCTCTTGAGGGGAGCATTTCTGCTGGCTCCAGGACTTTGGCCATCTA
TAAAGCTTGGCAATGAGAAATAAGAAAATTCTCAAGGAGGACGAGCTCTTGAGTGAGACC
CAACAAGCTGCTTTTCACCAAATTGCAATGGAGCCTTTCGAAATCAATG
gtaaagtacgattccccaataatggaaatgaccagaaatgtagtctttctgctagcgaga
tacgaaaatagacaagtcaatagaaagtctaggtttggcttattgctgcattttgcacgt
aatcatcactaatactgtctggagtgcttcaatttggaatttctggaatgctaataatag
EXON 2  102 bp
ttttgctttgtggcaagaaagaggattgggggatgatttgggagtcatgagcttttggtg
tctttcccagctgacctcacagggtgccccctgctcacatggagtagggcctggagcagg
cagggacttcctgtgctgtgttctctgcagcagcctccttcctcctggcttgtgtttcag
TTCCAAAGCCCAAGAGGAGAAATGGGGTGAACTTCTCCCTAGCTGTGGTGGTCATCTACC
TGATCCTGCTCACCGCTGGCGCTGGGCTGCTGGTGGTCCAAG
gtaaagcaggcttggtcctgtgtagtccctcctggggggagaggggtgacccagctgggc
ccctcagatgaagggctcaggttgagtggagagcctcgggccactgctcccatctgctgg
gagacagtctcagcccctggcagccacagtgatgagaggagcaaagaaggagtgtatgtt
EXON 3  225 bp
gtggagcgcacatggtcaagatgtagaaaaggccgtgtgctcacgctaggtcctgacagc
acatggaatttgtgtttacaaattcagggcctgtagaagttatgcacacatgacacaaga
atgtcagggatatgctcaaatgcctcagtccctaaaagaatgctgtggggtggggcccag
TTCTGAATCTGCAGGCGCGGCTCCGGGTCCTGGAGATGTATTTCCTCAATGACACTCTGG
CGGCTGAGGACAGCCCGTCCTTCTCCTTGCTGCAGTCAGCACACCCTGGAGAACACCTGG
CTCAGGGTGCATCGAGGCTGCAAGTCCTGCAGGCCCAACTCACCTGGGTCCGCGTCAGCC
ATGAGCACTTGCTGCAGCGGGTAGACAACTTCACTCAGAACCCAG
gtttggcctcctcccctctgggtcaggacttctcaacagaggtctgggagacagcgggat
caggaaccaggaaattaaggaccctgtccaagcaaagtgtgacctccaagagccagggac
ttagagcaaccagctcaatgccaagtctgaacccagagtccccacatggatccagaatgt
EXON 4  36 bp
aggactctttcccaaaaaacagccaggtgcttggctcctgttgtccaaacccccacagtc
tgatgggagccccacacaggagggcttaccctcccactgcagaacctgggcactctcagt
tggggcttgggccaagggtaccccacagctcagctgcagctcactctccttcccttgcag
GGATGTTCAGAATCAAAGGTGAACAAGGCGCCCCAG
gtaggttcatttccactcacacccaccctgctctttccccaaaacctccccaaaagggcc
ccttggcctgtgccattctgggtctggacagctgaccctagcttaccttcccctgtctcc
acagcctcctttgtcttcagttgggtctcctctctgttcccagaacttaactggactccc
EXON 5  108 bp
ctttctaggccatgggtttcttgcaggaggagctctgtcttctttccttctttccacaca
gttggctcatccccatgctcagtgaacgtttgttgaatgaatcaccatgtaagtgattgc
atggcgttgttgccccatcctgttgactgactcattagtgtctctgttcctcttcctcag
GTCTTCAAGGTCACAAGGGGGCCATGGGCATGCCTGGTGCCCCTGGCCCGCCGGGACCAC
CTGCTGAGAAGGGAGCCAAGGGGGCTATGGGACGAGATGGAGCAACAG
gtacgggtctttttcttctgacccttaatcattttcctcctccttctctggcttcactct
gaattccctttcccttccaggcccctcgggaccccaaggcccaccgggagtcaagggaga
ggcgggtgagtaggtgctgggtatgtacccagaaatacacagcaagtttctcagagtgac
EXON 6  45 bp
ggtcacaagggggccatgggcatgcctggtgcccctggcccgccgggaccacctgctgag
aagggagccaagggggctatgggacgagatggagcaacaggtacgggtctttttcttctg
acccttaatcattttcctcctccttctctggcttcactctgaattccctttcccttccag
GCCCCTCGGGACCCCAAGGCCCACCGGGAGTCAAGGGAGAGGCGG
gtgagtaggtgctgggtatgtacccagaaatacacagcaagtttctcagagtgactgctg
tgggctgcagacgcagcctccctccagagtctggacctctgaggggtctgtaggtgaacg
gaggcctggtgggagaccccagaggggatgagaggctgggaagcaccctttctggtggcc
EXON 7  45 bp
tgattgtgtgtgtgcatgtgtgtgaaaaagagagagagagagagagtgagagtgagagag
agagaaagatctccttctgggaaccttgctcaactaagggaatctagaatgtcagctgat
taaagacattttagacattctcaggccacagcaactgagctcttttttccttcctcacag
GCCTCCAAGGACCCCAGGGTGCTCCAGGGAAGCAAGGAGCCACTG
gtaacttgtacttgctctgctagggacaaatgatgcatagcctgaggcactgaggcagtt
cccccccaccccccatcctctttccacagccccaccccagcccctgacagttactgccca
ccctacagtcctcttctcttgagtcctgtcacatttcttcaagaccacccaagaaatgag
EXON 8  108 bp
cttctcttgagtcctgtcacatttcttcaagaccacccaagaaatgagctagcacatccc
ccagaggaaatctggggatcccattcccttctctcccaaatgcttcctgcccctttgcct
ctggtagcctgtccccaaaaggatagtgggagcccatctcaccagccattctctttgcag
GCACCCCAGGACCCCAAGGAGAGAAGGGCAGCAAAGGCGATGGGGGTCTCATTGGCCCAA
AAGGGGAAACTGGAACTAAGGGAGAGAAAGGAGACCTGGGTCTCCCAG
gtgagggccgtattgggggtgtcggtgcttgccaggaggcctgagggaactagggcctga
cctctgtgccattgggtctattcagtgcccactgagggcaaggcagtgctctgtctatgg
gaatctctggagcaccacacatagtctcttctttccgggtgagcaaagagatgcaatatg
EXON 9  99 bp
tctggggcaaagcggtgcactccttgagggcagcggtcatatcttccactcgcgggcacc
aagtaggagctcaaggagtttagggtttgggatttcagtggaatgggaagtgtcagagga
ggacatggtggcctgattggagttcctcccacaactaaccaagactttttggtttttcag
GAAGCAAAGGGGACAGGGGCATGAAAGGAGATGCAGGGGTCATGGGGCCTCCTGGAGCCC
AGGGGAGTAAAGGTGACTTCGGGAGGCCAGGCCCACCAG
gtaagagggcacgtggtcacatccactgacctctaggtatttccttttttttttttttct
ggctggctgagccaaaggaaaaaaaaattcctaaaagttctttttcatcttaggtttggc
tggttttcctggagctaaaggagatcaaggtaagaactacaggaatctgggcatcatccc
EXON 10  36 bp
gcaggggtcatggggcctcctggagcccaggggagtaaaggtgacttcgggaggccaggc
ccaccaggtaagagggcacgtggtcacatccactgacctctaggtatttccttttttttt
tttttctggctggctgagccaaaggaaaaaaaaattcctaaaagttctttttcatcttag
GTTTGGCTGGTTTTCCTGGAGCTAAAGGAGATCAAG
gtaagaactacaggaatctgggcatcatcccagctacgactgtccctggcagagtgaagc
tggggaccagacaccaccatcttttgcttcattgtagtattcacccagaacacctggggt
tttttagacatctggccctggccaagaggaacagagcagccagtgggcggtgggggcagg
EXON 11  99 bp
attttcctcctactaagagggctagctcatggcttctaaagagaggtgttaaagctgcca
agaggactgtaaggtgttaagaggtacatgtctcactgctgaaaacagaagcactggggg
ttggggtatctgggccctctgccaaccaccacagcctggcagtcactactttcctttcag
GACAACCTGGACTGCAGGGTGTTCCGGGCCCTCCTGGTGCAGTGGGACACCCAGGTGCCA
AGGGTGAGCCTGGCAGTGCTGGCTCCCCTGGGCGAGCAG
gtgaggtcctgggtcctatggtgggcacagggagtgatgtgtgaaaacctgcctagtcca
gcccttatgctctctgtggtgtctgttgtccaggacttccagggagccccgggagtccag
gagccacaggcctgaaaggaagcaaaggggacacaggtaacagagggtgcagtgggtgag
EXON 12  63 bp
tgcagggtgttccgggccctcctggtgcagtgggacacccaggtgccaagggtgagcctg
gcagtgctggctcccctgggcgagcaggtgaggtcctgggtcctatggtgggcacaggga
gtgatgtgtgaaaacctgcctagtccagcccttatgctctctgtggtgtctgttgtccag
GACTTCCAGGGAGCCCCGGGAGTCCAGGAGCCACAGGCCTGAAAGGAAGCAAAGGGGACA
CAG
gtaacagagggtgcagtgggtgagtaggtgggcttgctgggtggcaggatggatggagag
aaaaactgcttcttcttaggcccacggaggaggcagagggtcttctgtgccttggcctct
gaggttcctggttatgggggcagttgcccctgccaggaccccttaagcccaagggcctag
EXON 13  45 bp
ttcatctgcagactgtctcttttcatgatctgctgaagaggctttaaacaatcgtggaga
accaatgtatctttccatctgcattaatcagacaaaaggtagaggttgtctaagattaaa
aatgtctaatacctaagttttattatctcctccccccccccttttttgttttgatcttag
GACTTCAAGGACAGCAAGGAAGAAAAGGAGAATCAGGAGTTCCAG
gtaaagggcaggctgcatcttcatccctcggagtgatgacggggaaggcctgccttctca
gagggcaggtcttgttgacattgaatgcacagctgtgaccttctcccaaagtggaggtta
agactccagggctctgtcactcaagcctcagatttctccgctgcaaaacctgggaaccac
EXON 14  99 bp
agagttgagagatcagtgcagcccccagatggaccaaagacaggctgaacattcagatag
cccagccatgggggaggtctggcagttaaggataactcatttattaaacagtaatgccct
tgggtctctcttgggaaggcaaagcagggcacctgatcagggcagtgtctctccttccag
GCCCTGCAGGTGTGAAGGGAGAACAGGGGAGCCCAGGGCTGGCAGGTCCCAAGGGAGCCC
CTGGACAAGCTGGCCAGAAGGGAGACCAGGGAGTGAAAG
gtaaggcctctgcatctgattcctttgttcttaggactgtgctttacagccagttctgta
ccttaaaataggaaaggcgctgttttaagagttctggggattttcagaacccaggagggt
agaggtttatttccttgattgacaagtcttgtgctggggcttgccctaggcatggagcac
EXON 15  45 bp
ttcctgctcagtcattgacacccgcaggacatcccatccccataatgccaggccacaggc
gagacccacggagcatctgaccactcccaaccctccacccgctccccactcatgcaaatg
caggcaaaggcgtcctgcctgggtttctttcaaaccgtgtgggttttctcctcatgacag
GATCTTCTGGGGAGCAAGGAGTAAAGGGAGAAAAAGGTGAAAGAG
gtaatcactatttatattatctttaatgtgtgctttaaagtcaattctgcacctgaaaat
tgtgtgtgttgggggaagagaccttggttctcaaataaatttctcattttggggaggagt
tgagggtctagtcccttgaatgagcctgcccacggcacagagcagcagtttctctcccca
EXON 16  177 bp
aggctgcgtgccaggttgggttggcactgtaaagtgggatcttccaggctctggtgacag
tcaagcaggggcatttcttttccttaactgtagaactccaaaatgaaaagaaagagcccg
cacttacccaaagccccaaggggccttccttgcctctcccatgtgtgtttcttcacccag
GTGAAAACTCAGTGTCCGTCAGGATTGTCGGCAGTAGTAACCGAGGCCGGGCTGAAGTTT
ACTACAGTGGTACCTGGGGGACAATTTGCGATGACGAGTGGCAAAATTCTGATGCCATTG
TCTTCTGCCGCATGCTGGGTTACTCCAAAGGAAGGGCCCTGTACAAAGTGGGAGCTG
gtaagtgagtcatcagccgggggcctcttccccagaggtgtggatgtggctttctctcgc
tggtggggtgttggcaagtgactcagtgtggttttctttaaaagaaaaatattggtccaa
gcaaccaaaaagctctgcagtgcagggctccaggtatgcatccttccagcttggcaaccc
EXON 17  269 bp
acaacaacaacaacaaaaacaggctaagccagccatcagcacattgggccggaatgggcc
agaatgagtgagaagtcggcagtccacctcagatggaagctcccaggcgcacacgtggct
tctttgctttgactctaatcctacccttcttcctctgtctcttgctttctctctatcaag
GCACTGGGCAGATCTGGCTGGATAATGTTCAGTGTCGGGGCACGGAGAGTACCCTGTGGA
GCTGCACCAAGAATAGCTGGGGCCATCATGACTGCAGCCACGAGGAGGACGCAGGCGTGG
AGTGCAGCGTCTGACCCGGAAACCCTTTCACTTCTCTGCTCCCGAGGTGTCCTCGGGCTC
ATATGTGGGAAGGCAGAGGATCTCTGAGGAGTTCCCTGGGGACAACTGAGCAGCCTCTGG
AGAGGGGCCATTAATAAAGCTCAACATCA
ttggctgtggctgagtgtcactgtgttcatacctcccatccccattgatgtgcccactcc
atgcaccacaacatttcattgaattctctcatgtccgtagccaggggaaggagaggttgg
aggtggtgaggcagaaggtgaaggtcacctatggtcaaccttagtcttgaccatctcttc