Gene LRP2 Variant 1
DNA : 234.15 KbNT_005403
mRNA : 14385 bp NM_004525
CDS : 13968 bp NP_004516
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  183 bp
agtgcagggggcgggccgggcggcagggggcctgcccgctggattcccgcatgcttgttc
cggggcggtcgggtctaaagggctttatgcactgtctggagggtggggactggcgcgggt
agaaaacgggatgcctcgggcgtgggggcaggcttttggccactaggagctggcggaggt
GCAGACCTAAAGGAGCGTTCGCTAGCAGAGGCGCTGCCGGTGCGGTGTGCTACGCGCGCC
CACCTCCCGGGGAAGGAACGGCGAGGCCGGGGACCGTCGCGGAGATGGATCGCGGGCCGG
CAGCAGTGGCGTGCACGCTGCTCCTGGCTCTCGTCGCCTGCCTAGCGCCGGCCAGTGGCC
AAG
gtaagagcccagccagagcctctcgtggagcccccacttccccggctgtggcagggtcgg
gtccgcgggaggccggaggggagagcgtccgggcaggggctagggccgggcggcggcgcg
ggagctgctcccggtggggcgctcaggttgcttcgcgaagccggagcgggagcgcccctc
EXON 2  108 bp
acggatgttcaaataaatatttttatattatcattgggagaatgtttacctaattttcta
atttgcatttctttgattatctaattagttgaataatttttcattttatcaaaaatttat
atttcttcggttaaatatctgcatggcataagtttttaaaatttctgtctattattgcag
AATGTGACAGTGCGCATTTTCGCTGTGGAAGTGGGCATTGCATCCCTGCAGACTGGAGGT
GTGATGGGACCAAAGACTGTTCAGATGACGCGGATGAAATTGGCTGCG
gtaagtgaggaggggccaggctaagttctattttgagtaacctaagtgcttcctggtgat
ttcagctgtaacaaagagaagagctatgccttttagtgacagagccaggtctgggcccaa
gtcttttgagatctgtgtggttgaatagagaactgatggcattaacaataatttcactcc
EXON 3  123 bp
gcttatttgacagtgaactctgactggcgtccacagactctagtataagggttgtttact
atttgccttcaaataaattgagcaggagtttacatgatacactcttctggaacaagcatt
gcttgctagtataatggggaggatgattgccataatgagtcctcttttggtttgttttag
CTGTTGTGACCTGCCAGCAGGGCTATTTCAAGTGCCAGAGTGAGGGACAATGCATCCCCA
ACTCCTGGGTGTGTGACCAAGATCAAGACTGTGATGATGGCTCAGATGAACGTCAAGATT
GCT
gtaagtgtttggagaggaatcttgctttggctttgtggacacctaaaacccaacctgtcg
caaagaagttacacacaatgggatgattctttataaatgtggagcagggccttaaatcat
aagggaacctatgccagcaatctcattcaggggttggatgatattgaaagtacggatgta
EXON 4  117 bp
tgggcattttgataacattatacttctgtttttgctttgtaagctcagcttggtggtagc
caggtactttaccttgtgtccctatgaactttatgctttccaatatccttgttaatgaca
atagattagtctgtgtctagcaataattataaattaagtaataattttttctcttcgcag
CACAAAGTACATGCTCAAGTCATCAGATAACATGCTCCAATGGTCAGTGTATCCCAAGTG
AATACAGGTGCGACCACGTCAGAGACTGCCCCGATGGAGCTGATGAGAATGACTGCC
gtgagtctgttttagtccttgcactgtatttggtttcacccttgtccctttggcatttta
atcaatttgttagatttgttgatggacataaatgcctacaatatgcctcttgttattgca
atctcttggcagattcttttgtggattaggggtgatgttctgataagagtctatttttaa
EXON 5  111 bp
ctgtctcccatgtccagccttactctccatgaagccagggagcatacttcttttgtgtat
caatatatgcatttagtgacttgcatatagtaatcactcaataaatgtttgctgaaggaa
atttaaggtttgtttactgtttccttttcctttttttttttttttttttttttacaatag
AGTACCCAACATGTGAGCAGCTTACTTGTGACAATGGGGCCTGCTATAACACCAGTCAGA
AGTGTGATTGGAAAGTTGATTGCAGGGACTCCTCAGATGAAATCAACTGCA
gtaagtattgtgcacaagatgtgcagttgtgtgctgaagctggtttatactggtttgaga
gagccaatatgtacatctcttcccaagttcaggttcagtgaattcatgttggtagtttga
agtcagccgttggtaggagtatttacacactggaaatcggcaaacactacaaaccagggc
EXON 6  114 bp
ggcaaacactacaaaccagggcctttttgttcctggataactggttcttaaacagttacc
agcacaccactgcttaataagaatccctttttaaactggagatgctcttcctttgagatt
aaatggctacaatggagttaacttctctcttttctttcccttcttaactttctgttgcag
CTGAGATATGCTTGCACAATGAGTTTTCATGTGGCAATGGAGAGTGTATCCCTCGTGCTT
ATGTCTGTGACCATGACAATGATTGCCAAGACGGCAGTGACGAACATGCTTGCA
gtacggtgatttctttatgctgggtcatgttgttgggagtgttttgttttgtttcggttt
tgttttgttttatccccccgctcccccaccaatgtacctcttttttcaaggagaagagtc
actacgtttgatggcagatggaatcagacggtcactagggggtcttggcacaagcctttg
EXON 7  117 bp
cttcttctttctctctcttttttttcctcctttttaaaaatttttgtcaagatgtctaag
ggattaaattgatatagaaatttcaatttctaggagtactgcttaggcagtgaggtgaga
gcactttcagtttttcccggtgatttgtgtctttggagtgcagctgttgctttattccag
ACTATCCGACCTGCGGTGGTTACCAGTTCACTTGCCCCAGTGGCCGATGCATTTATCAAA
ACTGGGTTTGTGATGGAGAAGATGACTGTAAAGATAATGGAGATGAAGATGGATGTG
gtaaggaggggaagagattcctactgaaaagcattttcttcaagtgttttccagcgcttg
ttttttctcctttcctttttagaaattttgtgtgacaagcaagcctcaggattggctgga
gttgaaggggttgtttaggaacttagtgggtggggaagacggaggtgactgcgctaactt
EXON 8  153 bp
ccttagaatctcagtaaaagactagtggtagagttagaaatcactaacttattgtaaaat
gtagatcatttatagatttctcttgttcaacttgctctacatcctctgtaaaccactgat
taacaaagagctggctgtacctcccctatggcctgtaactctctctttttccccccacag
AAAGCGGTCCTCATGATGTTCATAAATGTTCCCCAAGAGAATGGTCTTGCCCAGAGTCGG
GACGATGCATCTCCATTTATAAAGTTTGTGATGGGATTTTAGATTGCCCAGGAAGAGAAG
ATGAAAACAACACTAGTACCGGAAAATACTGTA
gtgagtatagacatttacctgggtagctttcagataaagatatttctgttttctagaaca
gacgttcaaatacagtgtatctgttggcatttgcataacaaagcaccccaagacttagtg
gcataaactgagaaacgtgtcttatttctcacagttctgtgggttggctaggtagttcct
EXON 9  120 bp
ttcctgtctcagttgaacttttattgcaaagttttgcagtaagctttgaagggtgacaga
tttttctgtacatctacttcatgcttactgagctgctactcatggaaaaagaagctatta
gattaatcagtcttgtccagaggtcaccattcatttaacaaagttcttttcttcgtttag
GTATGACTCTGTGCTCTGCCTTGAACTGCCAGTACCAGTGCCATGAGACGCCGTATGGAG
GAGCGTGTTTTTGTCCCCCAGGTTATATCATCAACCACAATGACAGCCGTACCTGTGTTG

gtaagtgatggggggcggcggctacttgtctttcattacagtacactgatgggtgccctg
atctctgacatctaggaggttgcacttgtggagagtcgtcatggtctgtcataacaaaga
gcaacccagacctcacagaaaacctggcaaatagggaattttaactctgagaaggtttgg
EXON 10  129 bp
ctttttccttacatgaagatggttgttataaattctcagaacctgtgcctaattccagag
ggtgtttatttagacatgggcaacaccacattcttggccatcttatctaggatttttgtc
agagagtgcttaataaatgctgataaccttgactacaaatgtgtattttccatatggcag
AGTTTGATGATTGCCAGATATGGGGAATTTGTGACCAGAAGTGTGAAAGCCGACCTGGCC
GTCACCTGTGCCACTGTGAAGAAGGGTATATCTTGGAGCGTGGACAGTATTGCAAAGCTA
ATGATTCCT
gtgagtaaattatggacacctgtgtctctgaacagtgaacagattctaatagcttctttc
cttccttctgatgacaacagaattatcagcatttttgttgttggcagggctttatcatta
caaatcagggatggctcctactgcctagaaaaattggtcaacattaatttcatactttga
EXON 11  170 bp
tgcccttctgtaaaatggatagaatgctagctatctgtctgcctcagaggtttatgttaa
aatcaggtaagacaacctagaagatagcatttgaaaaagcagaaagcatatcatttgtaa
gctacttcaccatccttgctcatctgaaggagtggtgatgccttccttcttcgcatttag
TTGGCGAGGCCTCCATTATCTTCTCCAATGGTCGGGATTTGTTAATTGGTGATATTCATG
GAAGGAGCTTCCGGATCCTAGTGGAGTCTCAGAATCGTGGAGTGGCCGTGGGTGTGGCTT
TCCACTATCACCTGCAAAGAGTTTTTTGGACAGACACCGTGCAAAATAAG
gtaaatagaaatttcagtagctgaatggaaccctgagcacaaagtgttgatagcttttca
cttttagagggagtagaggggaaagttcctttgttttctaacaaaaaaggcccttgagat
attttatgttaatcagcaccttttccatgctatactattacatgtgacctattaaacaaa
EXON 12  224 bp
acattttattataccattaatacgattctcatttatttaaatgataacttgcatgaaatt
tctgaaaattgagaatttagatttttagcacttctgatttgattatagctaaaaaaaatc
aaaacaaaccacgtagttagtgatgctgaagaaatataataattttggtttttctttcag
GTTTTTTCAGTTGACATTAATGGTTTAAATATCCAAGAGGTTCTCAATGTTTCTGTTGAA
ACCCCAGAGAACCTGGCTGTGGACTGGGTTAATAATAAAATCTATCTAGTGGAAACCAAG
GTCAACCGCATAGATATGGTAAATTTGGATGGAAGCTATCGGGTTACCCTTATAACTGAA
AACTTGGGGCATCCTAGAGGAATTGCCGTGGACCCAACTGTTGG
gtaagtgatgtgaaaacatattgattcctgtatttttagaattttctctctccctctata
cactgaacatctactggattaatcaaaggctcattctgatttcttttaggctgtatactc
tagaagccatgtctattttgtgcccttatttatagaagctttaagagagtttattaaata
EXON 13  207 bp
ctgactgacccccacagtctctttaaaaaaaaaaaacaacttaatttccctgttgtttta
tactgtggttctctaatcagctggataaaatttccattgatccaaacacactgttaaaaa
aaattcccaggttaacttgtaaaataccagattctttcatcttctgtttttcttttgtag
TTATTTATTTTTCTCAGATTGGGAGAGCCTTTCTGGGGAACCTAAGCTGGAAAGGGCATT
CATGGATGGCAGCAACCGTAAAGACTTGGTGAAAACAAAGCTGGGATGGCCTGCTGGGGT
AACTCTGGATATGATATCGAAGCGTGTTTACTGGGTTGACTCTCGGTTTGATTACATTGA
AACTGTAACTTATGATGGAATTCAAAG
gtaagaagtattttttatggcttatggctttataagttgcagggaaagtgcataaaatgg
ctgcagagaaatatcaaaggaccagaattaaaatattgctttgttggtggacatgatagc
tttaatgacctttgtactgacatttgcatgaagtgacctgctctattttgttaacttttc
EXON 14  203 bp
tccttctatcatatgtagatggaaatatgtatacatctaaaatgtatcttttctatctat
tccgtatttgtgacaagaaattatttagcttttcaggcatttaattgaactaactacagc
tttaattataataaagcaaaactaacaaattgtatgatatatatgtgtcttttataacag
GAAGACTGTAGTTCATGGAGGCTCCCTCATTCCTCATCCCTTTGGAGTAAGCTTATTTGA
AGGTCAGGTGTTCTTTACAGATTGGACAAAGATGGCCGTGCTGAAGGCAAACAAGTTCAC
AGAGACCAACCCACAAGTGTACTACCAGGCTTCCCTGAGGCCCTATGGAGTGACTGTTTA
CCATTCCCTCAGACAGCCCTATG
gtaagcctcagagcagtggtaaccatgcttggtaccggacttggtggaaaggttttctca
aagctttgaaagttaataatgaggggtcttatgtgatttgggtggcattctcaagtatat
gaagggttacccagagtgttaaactctctgaaactggttctgcaggttaggagcattctg
EXON 15  141 bp
gggagggttagtgtagccagatgtggatgtatccagtagtaaccagtagtaatgttttca
acacgttgctaatccattactctatttcacctataggtgaaaagggctagaagtggcttc
atgtcttggataattacacatttctaattgcaatttaaccctgtgcatttttccttccag
CTACCAATCCGTGTAAAGATAACAATGGGGGCTGTGAGCAGGTCTGTGTCCTCAGCCACA
GAACAGATAATGATGGTTTGGGTTTCCGTTGCAAGTGCACATTCGGCTTCCAACTGGATA
CAGATGAGCGCCACTGCATTG
gtaagaagtctgttttggacgttgttggcaggtgacacaggtgtatgtgtgtccaaacct
ctaactagactaactgctactcttgaactggaccagctccctgtctaacttcttgactgc
aaataagctttctgtagcccacagggcatcttccttggtaggcaccacttctactataca
EXON 16  204 bp
ttatctttttttcttccctgtattatttctaactatgctttccaaaaatttatttttaca
tttatttcagaattatattttataatttaaagtttgctctgtggatgcatttatctggaa
tttgggaggagagaaaagaaccatgctgtgactgactgtgctgtgttattcttcctacag
CTGTTCAGAATTTCCTCATTTTTTCATCCCAAGTTGCTATTCGTGGGATCCCGTTCACCT
TGTCTACCCAGGAAGATGTCATGGTTCCAGTTTCGGGGAATCCTTCTTTCTTTGTCGGGA
TTGATTTTGACGCCCAGGACAGCACTATCTTTTTTTCAGATATGTCAAAACACATGATTT
TTAAGCAAAAGATTGATGGCACAG
gtgagaaaggtttgtgtgtgtgtgtgtgtgtgtatgcgtgttttgcctgtttattgtaat
gatacttacaacttgataattaaaactcagtatctaatttttaagcagtcttatttattt
atttatttatttatttatttatttatactattttactttaagttctagggtacatgtgca
EXON 17  193 bp
gtctcatgttattgctcagcagcttacagagtttttttttttttttttttttaaagaatt
ccacatgtgttcctgaaatatgctctaactctgacacaaaatttcagtgtgcattagtag
gaaaattgatgccttacaaaatatacttagcttaaaatatgtccatattttaacttatag
GAAGAGAAATTCTCGCAGCTAACAGGGTGGAAAATGTTGAAAGTTTGGCTTTTGATTGGA
TTTCAAAGAATCTCTATTGGACAGACTCTCATTACAAGAGTATCAGTGTCATGAGGCTAG
CTGATAAAACGAGACGCACAGTAGTTCAGTATTTAAATAACCCACGGTCGGTGGTAGTTC
ATCCTTTTGCCGG
gtaagtgtgttcatgttttcctaagagcttgaaactgtatgtcttttacagtcattgaaa
agtgatgccctagggatttaggtaagttcagcaaatataagattgaactgtataagttga
aatcaccttaaattttatttcttttttcctccaaaaaactttattctgggggagtaaaaa
EXON 18  126 bp
gttaactaaattttaactgagaattacatgagttatacactaagtatgttaagttcaata
gcatataaagaaaacaaaattaattgcagtatctggagaatctctgtttgttctaaatct
ctggaagtcatgtagtttgtcccagtgttaacagccttaatttactactgctttttctag
GTATCTATTCTTCACTGATTGGTTCCGTCCTGCTAAAATTATGAGAGCATGGAGTGACGG
ATCTCACCTCTTGCCTGTAATAAACACTACTCTTGGATGGCCCAATGGCTTGGCCATCGA
TTGGGC
gtaagtaggaatcatcatccccgatacttagttctcttttactgcagaacacataatgag
gcaggttgggtgatatgatggtgtaaggaaactggtactgcttgccctcgcggaatttta
aataattaattggtgatgggagaaggatattgaacaagaacacaaaggacataaacatag
EXON 19  131 bp
aagtagccgtctctttctgggggacataaaactgttaaatttttaatgaatataatttaa
attttaaaaactttgtttaataaatgtgtcaactgaccctactgtttttggatgcccttt
gtgtaaagggtgctctgatagtttttggataagagataactaaatattttattattttag
TGCTTCACGATTGTACTGGGTAGATGCCTATTTTGATAAAATTGAGCACAGCACCTTTGA
TGGTTTAGACAGAAGAAGACTGGGCCATATAGAGCAGATGACACATCCGTTTGGACTTGC
CATCTTTGGAG
gtatgttttaaagcaataaaagtatgtattgtttttatacattgcaagttacaatagtaa
actcatcctcatgtggcattttcacaatcccagaaaagctggccactttaaaatgaaaaa
atttaaaatggtgctatatatttagacaaaacatttggtttgttgatggtgtatttcatt
EXON 20  138 bp
acagagcattactagggagtaacaagtcgtggaaaatggttagagaaacatattacagat
atttatgggggagatgatcgtacttgcaagaagcatttcaagcctattgcattttctcaa
gtgatttatttataagttagctgtgactgaaaatactaatctacccatgtttcttttcag
AGCATTTATTTTTTACTGACTGGAGACTGGGTGCCATTATTCGAGTCAGGAAAGCAGATG
GTGGAGAAATGACAGTTATCCGAAGTGGCATTGCTTACATACTGCATTTGAAATCGTATG
ATGTCAACATCCAGACTG
gtgagtgagattgcccagttttttttatttttttgtatgggtttatttatttgttacagt
ggctcctgttctctttaagtacttattacttaaaggtctagctcctggtagttttatatt
cttgtcgttcacataatctaagagtgtaagacttgaaatctctgttcaatgctgctagcc
EXON 21  282 bp
ggacttttccatacctaaatggaatgttgtatttggcgggttgatttccaagaggaagct
actttttagtattgggtctgaaaaatgttttgtcctgtttgttttccttcacaaatcaaa
cccgtgacctacctagtgaaaatgtacatgactgactccctcggggctttgcttttgcag
GTTCTAACGCCTGTAATCAACCCACGCATCCTAACGGTGACTGCAGCCACTTCTGCTTCC
CGGTGCCAAATTTCCAGCGAGTGTGTGGGTGCCCTTATGGAATGAGGCTGGCTTCCAATC
ACTTGACATGCGAGGGGGACCCAACCAATGAACCACCCACAGAGCAGTGTGGCTTATTTT
CCTTCCCCTGTAAAAATGGCAGATGTGTGCCCAATTACTATCTCTGTGATGGAGTCGATG
ATTGTCATGATAACAGTGATGAGCAACTATGTGGCACACTTA
gtaagtagctatgcactggcgatatttcctgggatgaatagagtagaggtgggctttaaa
gaaaataaataaaagcttgggctatttatatgggaaaaatatcttttagaatttcagatt
cttaacatgcactttgaaggcttttaggaagctaagcaagaaatttcattcataatgtta
EXON 22  240 bp
ataccaaataaatgccagccaataatgatgttagtgatgatgacatcacttgatgaacat
ttctccttattatatacaatgcctccattaaaaaaggtgaactgagcctttataaggcaa
gaactcatttaaaaggctgtaaaaacaaatgtcttcatgaccagtttgttactattgtag
ATAATACCTGTTCATCTTCGGCGTTCACCTGTGGCCATGGGGAGTGCATTCCTGCACACT
GGCGCTGTGACAAACGCAACGACTGTGTGGATGGCAGTGATGAGCACAACTGCCCCACCC
ACGCACCTGCTTCCTGCCTTGACACCCAATACACCTGTGATAATCACCAGTGTATCTCAA
AGAACTGGGTCTGTGACACAGACAATGATTGTGGGGATGGATCTGATGAAAAGAACTGCA

gtaagttttgagctggtttcccttggttggtcagcctcgtaaatagacttcaacaaccaa
atggccttgcattctttcctctaaggctcatgcaattttcattgtctctttagtacttct
attccacttgtcaatctctgtgtcaataggttacaagaacaaaggcacgtgcctgcacat
EXON 23  120 bp
acctatcctagttttgagttcttttgcttagctgactttgatagtgtggctgattcaaaa
gaattttgaacccatgtacaattgagataacttctgtagctatttagccatttttagttt
ggctctggtacttgttgcacaggaaataaacttgttggttttgttttcggatgacattag
ATTCGACAGAGACATGCCAACCTAGTCAGTTTAATTGCCCCAATCATCGATGTATTGACC
TATCGTTTGTCTGTGATGGTGACAAGGATTGTGTTGATGGATCTGATGAGGTTGGTTGTG

gtaagtgcattgccttcttttttattcacaatgtttatttagaaaaatctcagtgttaac
acatggacacagggaggggaacatcacacaccggggcctgttggggggtggggagctaga
gaagggatggcattaggagaaatacctaatgtagatgatgggttgatgggtgcagcaaac
EXON 24  117 bp
gtagatgatgggttgatgggtgcagcaaaccaccatggcacgtgtatacctatgtaacaa
acctgcatgttctgcatatgtactccagaacttaaagtataacaacaaaaaagaaaaatc
tcagtgtttagtcattttagccctgagctaatttctaatgcttttctctttcattcttag
TATTAAACTGTACTGCTTCTCAATTCAAGTGTGCCAGTGGGGATAAATGTATTGGCGTCA
CAAATCGTTGTGATGGTGTTTTTGATTGCAGTGACAACTCGGATGAAGCAGGCTGTC
gtaagtaacacatacccagaatgtttcagacaaaggggtcatttcatttttgccagtatt
gatattgatattgccacacattttccctaactcagacaaactgggggaaagtatcctcaa
aggaatgtggtattgaacatacagtaaaattgagtagacattgccatataatgtgtaatt
EXON 25  378 bp
tatttctatgtactagagtgtgggagaagactctatatcatttagccttaaatattaatt
tggtcatagttgttactataaacctactattggatccaaaatcatttcctctgagtctag
actataaaagggatcacaaattacattcacaagccgatttaccccatgttttccttctag
CAACCAGGCCTCCTGGTATGTGCCACTCAGATGAATTTCAGTGCCAAGAAGATGGTATCT
GCATCCCGAACTTCTGGGAATGTGATGGGCATCCAGACTGCCTCTATGGATCTGATGAGC
ACAATGCCTGTGTCCCCAAGACTTGCCCTTCATCATATTTCCACTGTGACAACGGAAACT
GCATCCACAGGGCATGGCTCTGTGATCGGGACAATGACTGCGGGGATATGAGTGATGAGA
AGGACTGCCCTACTCAGCCCTTTCGCTGTCCTAGTTGGCAATGGCAGTGTCTTGGCCATA
ACATCTGTGTGAATCTGAGTGTAGTGTGTGATGGCATCTTTGACTGCCCCAATGGGACAG
ATGAGTCCCCACTTTGCA
gtaagtttcctgaccacagtttactggccataaactcattctgaacagtagcctggtgtg
catcaccattgtcacagtcactgtgtagctttgtaggaaggatttcagttcctctatgag
ttcacatctgtgtagggggtaaccataattgaattcaaatacatcaccattggataattt
EXON 26  249 bp
aaattagagcaaaccctgaacagcctgtggaactcacccaagtgcatgctgcacttagct
cttgtctgggcatcatattgaaggtggcatgagactgcataataaatattgcataagagt
gaatcaaagaagcaaagattcttgattttcttttttcattattctctttcttttttctag
ATGGGAACAGCTGCTCAGATTTCAATGGTGGTTGTACTCACGAGTGTGTTCAAGAGCCCT
TTGGGGCTAAATGCCTATGTCCATTGGGATTCTTACTTGCCAATGATTCTAAGACCTGTG
AAGACATAGATGAATGTGATATTCTAGGCTCTTGTAGCCAGCACTGTTACAATATGAGAG
GTTCTTTCCGGTGCTCGTGTGATACAGGCTACATGTTAGAAAGTGATGGGAGGACTTGCA
AAGTTACAG
gtaattgctgaactaacccgagccagtttatcagcacatcccagagcttaaaatcaaatg
gcacatgtaggtatttgacaatgttgattaggagttagatcgacttgaatcctggaaaga
ttatgcaatctctttaaacctcaattttttgtgaggattaaatggggtaatacacattaa
EXON 27  212 bp
ggttaagaatgaagtgattaaaatcattcatatggggcttcctcccctccccaccaactt
actatagtttggaattacaccttctttctgttaccaaaagtattgaatcaaaagttttaa
agagttgttttgtgttttctcccagtatcattgacatttttgcatttttttcttgaacag
CATCTGAGAGTCTGCTGTTACTTGTGGCAAGTCAGAACAAAATTATTGCCGACAGTGTCA
CCTCCCAGGTCCACAATATCTATTCATTGGTCGAGAATGGTTCTTACATTGTAGCTGTTG
ATTTTGATTCAATTAGTGGTCGTATCTTTTGGTCTGATGCAACTCAGGGTAAAACCTGGA
GTGCGTTTCAAAATGGAACGGACAGAAGAGTG
gtaagtacatttctgttgacctttggcctggctagttcctctgtcttgggtctgtttgct
gttattcaccagtgagagaaggccctacctcatctgggtagctctcatggtaccttctgg
gccacatcatacccaagagacttgcgtgttcataactacgaatttatggctgttttagat
EXON 28  185 bp
ttttctcagaaaaccctgctgttgatttggtggttagctacatgaggagacaaaattttc
taatccccacaagtaattataggacaagttagatggtttaatctagatttttatataata
tccatgtttgcattcatttatttgctctagaattcactctttattcacttttgtctttag
GTATTTGACAGTAGCATCATCTTGACTGAAACTATTGCAATAGATTGGGTAGGTCGTAAT
CTTTACTGGACAGACTATGCTCTGGAAACAATTGAAGTCTCCAAAATTGATGGGAGCCAC
AGGACTGTGCTGATTAGTAAAAACCTAACAAATCCAAGAGGACTAGCATTAGATCCCAGA
ATGAA
gtaagacttttttttaaaattatgttgccttgacatggttatgatgagggaaaaacaaca
gtaacatgatgtagctgatatgcatgttgctgatatgcaaaatttaaaatgatcccttgt
ttaaacatggtaggtgtccaactgggtgttgctatctctccttcatctgaatcatcctct
EXON 29  229 bp
tgttatgacagttttactttgtgacacttagaggaaacaataaactctgtgaatatattc
tgaaccagagatgatttattttaagcagggcataaacaggatgttgtattatttaaaatg
acagttatttttaatatttaaatacgtcccctccaattggtaactcatttcctttcccag
TGAGCATCTACTGTTCTGGTCTGACTGGGGCCACCACCCTCGCATCGAGCGAGCCAGCAT
GGACGGCAGCATGCGCACTGTCATTGTCCAGGACAAGATCTTCTGGCCCTGCGGCTTAAC
TATTGACTACCCCAACAGACTGCTCTACTTCATGGACTCCTATCTTGATTACATGGACTT
TTGTGATTATAATGGACACCATCGGAGACAGGTGATAGCCAGTGATTTG
gtaagttggtggtgaggaaaaccaaattaaaactacagtcgtggataggtagaaatcaga
cgagtatcagaaaagctaagaaattaatttttgtgtcatagacattgtcagatcaatcca
ggaaataccagcaacagtgagaggcagtctatcccatatgactaactggaaaatgaatat
EXON 30  178 bp
gtgggatataggacgaattgtgtattttttgccgctcttttgcacaatgacttccttgtg
tttttattaaataatgacatgttaaaggaaaccgtcttcttgagcagatatcctctttga
ctcagtgcaccttggctttgatttttggatgaggtctcactgttctcttctgcctcacag
ATTATACGGCACCCCTATGCCCTAACTCTCTTTGAAGACTCTGTGTACTGGACTGACCGT
GCTACTCGTCGGGTTATGCGAGCCAACAAGTGGCATGGAGGGAACCAGTCAGTTGTAATG
TATAATATTCAATGGCCCCTTGGGATTGTTGCGGTTCATCCTTCGAAACAACCAAATT
gtgagtgatacagagaaacatcctgcctgggagtagcttgaaaaacactgaccctgggaa
tgctaaatgcacactgttacagacccatttgtttggacaatacattttccttttctcttt
acaaaccaccccactatatactttccctagtcctgacattgccattacttttatttacca
EXON 31  129 bp
agggaagttgaaagtgtgagtagttcagtgaaaacaaaacaaaagaaaacaacagaggta
acaacgtacttaagcccccctgtactggggcctctggaaggacactaagagcatgactct
gttttgattttaatgtggaggttttccacttactggtgctttcttctctttctcatgcag
CCGTGAATCCATGTGCCTTTTCCCGCTGCAGCCATCTCTGCCTGCTTTCCTCACAGGGGC
CTCATTTTTACTCCTGTGTTTGTCCTTCAGGATGGAGTCTGTCTCCTGATCTCCTGAATT
GCTTGAGAG
gtatagtatgctccttatgtgagctctgaagatggagctggtcatagtttgtgccaagca
gtggaaactctaaaaccaattgcgactgaacatgtgctgtgtcctttgattcctcaggtg
tctgcagaatgatgtgtgttgtatggggtgatgtcactgtgtgccttggttgtaatacag
EXON 32  167 bp
cagcccactgaaaccctgggaaaggcccatgcttgtctgatgaagtacattatatttatt
gctgcaatgctgcaatgtcattttagcccatatgatggtaacaggctattgccttccatt
actctaaatgtctgggaatagtgggatatgattttgactgatattcttctattttcacag
ATGATCAACCTTTCTTAATAACTGTAAGGCAACATATAATTTTTGGAATCTCCCTTAATC
CTGAGGTGAAGAGCAATGATGCTATGGTCCCCATAGCAGGGATACAGAATGGTTTAGATG
TTGAATTTGATGATGCTGAGCAATACATCTATTGGGTTGAAAATCCA
gtaagttttgaataacattcaaagtatataatttattcttgaagagcctgcctgcactga
tgttttcttataagcaaacttttgtcatgtgagtaaaagggaaacaatgtggaaataaat
ttatccctaagttttttgattcaatgaggggtatatatgtgagcttggcctggagcaaaa
EXON 33  144 bp
tgacacactgaaaaatcgtttgaagcctacccagtggtgctgaacctttgtttgcctttc
ctctgagtgtaaggactgttcaagaaatacagcagctggcagtagccacagtgaagaaag
ggttcttttgtaggagccatggccttggaactgctcacctccccttgtctttctttccag
GGTGAAATTCACAGAGTGAAGACAGATGGCACCAACAGGACAGTATTTGCTTCTATATCT
ATGGTGGGGCCTTCTATGAACCTGGCCTTAGATTGGATTTCAAGAAACCTTTATTCTACC
AATCCTAGAACTCAGTCAATCGAG
gtaatgattccataatactacttacacaaacattggatttagattgatgtaaactctagt
ctcaggaatagatctcacgtggattttggaatcatttttaagcaaaaagaaaaagggaaa
agatattagtgttaactatcaaagtctctgaagtgaaagaggaaaaccaccttaaaattt
EXON 34  110 bp
tgagctaatttcctcatttccctgaagtgcaatatagattatctgaatctcatgcaaatc
ctctctcatccatccctaatcgtgctttggaatttgttttgtacataagttctccttcat
ctcagtttcctttggttccccttatgaaagtcagttctaataagtgattttatgctatag
GTTTTGACACTCCACGGAGATATCAGATACAGAAAAACATTGATTGCCAATGATGGGACA
GCTCTTGGAGTTGGCTTTCCAATTGGCATAACTGTTGATCCTGCTCGTGG
gtgagtattcataaatggcacgtgtcttccatgcagcattgttcttgttaatgtcagggt
ctgacaaaatggaagatttcaaatttaggacatcttctgatttcatatgtcaacatttga
aaaataatagatctcagtgagaaagagaaatagctctgacctatatttaatgtgcaggat
EXON 35  178 bp
gacattggtagaacactggtgaagtacccctccacgttgtatgcaacgagatattgattt
tcagcctttgcccattgtattgtgagcatcttgaggacaagtaatacacattgtcattta
tgtcactgactcaaatccaccttctgttttgttacatgctggtgtttttcatggttgtag
GAAGCTGTACTGGTCAGACCAAGGAACTGACAGTGGGGTTCCTGCCAAGATCGCCAGTGC
TAACATGGATGGCACATCTGTGAAAACTCTCTTTACTGGGAACCTCGAACACCTGGAGTG
TGTCACTCTTGACATCGAAGAGCAGAAACTCTACTGGGCAGTCACTGGAAGAGGAGTG
gtatgagcaccctttcagtcttttggtctttatgctgagctggtgtagctgatgctgagt
gttctgagctgtcaggcagtggttcttgaacaatcttacttggtaacttgtaccagtgtt
tcattgccccttctcccaataacttctctcccttgcacgtacctcgcccctagctgaagt
EXON 36  214 bp
tcctgacctgctgcttggtgtcgttgtgatgatcaaatcagaaaatagaagtgaaaaatc
tctgtaagggatagagggctgtataaatgtgagacattataattaggagaatattagtgt
ttaaatgttcaaaattttcactatgaatccatgaaactaatgaaaattccaatcctttag
ATTGAAAGAGGAAACGTGGATGGAACAGATCGAATGATCCTGGTACACCAGCTTTCCCAC
CCCTGGGGAATTGCAGTCCATGATTCTTTCCTTTATTATACTGATGAACAGTATGAGGTC
ATTGAAAGAGTTGATAAGGCCACTGGGGCCAACAAAATAGTCTTGAGAGATAATGTTCCA
AATCTGAGGGGTCTTCAAGTTTATCACAGACGCA
gtaagtatttgtcactgaaatacattcatgggtgtataatgcatattcacacataactca
catttgtaagcacacacccacacacagtttcacgtacatacacgtgcatacaaattgaag
ttacctgaaatatttaaaaaatgataatgaagtcttaaacatggttaagtgccaagggct
EXON 37  240 bp
ttaggtgttattgtataagctctagtctctccgatgttgtttttagattgctaactcagc
tactatatgttggttattaatttttagaataaattatttggtgacccaattaaagaaatt
tgagatggggtggcgagtagctaggatcaaaagttacaaatggattttgttttcatttag
ATGCCGCCGAATCCTCAAATGGCTGTAGCAACAACATGAATGCCTGTCAGCAGATTTGCC
TGCCTGTACCAGGAGGATTGTTTTCCTGCGCCTGTGCCACTGGATTTAAACTCAATCCTG
ATAATCGGTCCTGCTCTCCATATAACTCTTTCATTGTTGTTTCAATGCTGTCTGCAATCA
GAGGCTTTAGCTTGGAATTGTCAGATCATTCAGAAACCATGGTGCCGGTGGCAGGCCAAG

gtatgccaactccaatataagtaagatttgacttcatctggcaccaggttgaaatccctg
gtgccatgaaaacatttcttcatgtgtggattcagtgcataatgaagctttcctttccct
ttaaatcaactggcacagcctaaagtgtttttcaaactttagtgtgtctcagaatcacct
EXON 38  189 bp
gaaagagtagaaaccaagatgtgggtctgctcactgcaactgggaaaaaagggtttcatt
ttgtaatggggagatgctcagagcagggggttgggaatgagggtttgagaggaagggcag
acatttaaaagttctaatttcagtgacagcattttttaatgatcttttcttaacttccag
GACGAAACGCACTGCATGTGGATGTGGATGTGTCCTCTGGCTTTATTTATTGGTGTGATT
TTAGCAGCTCAGTGGCATCTGATAATGCGATCCGTAGAATTAAACCAGATGGATCTTCTC
TGATGAACATTGTGACACATGGAATAGGAGAAAATGGAGTCCGGGGTATTGCAGTGGATT
GGGTAGCAG
gtatgtaagctatatggtgattttaatatgtttgcatctctgtcatcttattttatgcta
gaaagtttagcctaactccatgtgctacaggtttgtttttctagacaattattaagacca
tttaagatacattgaatctagattaagctacgtgtctatttgataaatgatacggtgttt
EXON 39  921 bp
aattcctaggagtaagaacttatttttctaagcctagactgggacactatcatcttggaa
aagacaacatatagtgacccagacttcaaccttatatattttgttctgaatttgtaaagt
tctccctttttttcttcttggttctccattgatcagcatgcactttcatttttcccatag
GAAATCTTTATTTCACCAATGCCTTTGTTTCTGAAACACTGATAGAAGTTCTGCGGATCA
ATACTACTTACCGCCGTGTTCTTCTTAAAGTCACAGTGGACATGCCTAGGCATATTGTTG
TAGATCCCAAGAACAGATACCTCTTCTGGGCTGACTATGGGCAGAGACCAAAGATTGAGC
GTTCTTTCCTTGACTGTACCAATCGAACAGTGCTTGTGTCAGAGGGCATTGTCACACCAC
GGGGCTTGGCAGTGGACCGAAGTGATGGCTACGTTTATTGGGTTGATGATTCTTTAGATA
TAATTGCAAGGATTCGTATCAATGGAGAGAACTCTGAAGTGATTCGTTATGGCAGTCGTT
ACCCAACTCCTTATGGCATCACTGTTTTTGAAAATTCTATCATATGGGTAGATAGGAATT
TGAAAAAGATCTTCCAAGCCAGCAAGGAACCAGAGAACACAGAGCCACCCACAGTGATAA
GAGACAATATCAACTGGCTAAGAGATGTGACCATCTTTGACAAGCAAGTCCAGCCCCGGT
CACCAGCAGAGGTCAACAACAACCCTTGCTTGGAAAACAATGGTGGGTGCTCTCATCTCT
GCTTTGCTCTGCCTGGATTGCACACCCCAAAATGTGACTGTGCCTTTGGGACCCTGCAAA
GTGATGGCAAGAATTGTGCCATTTCAACAGAAAATTTCCTCATCTTTGCCTTGTCTAATT
CCTTGAGAAGCTTACACTTGGACCCTGAAAACCATAGCCCACCTTTCCAAACAATAAATG
TGGAAAGAACTGTCATGTCTCTAGACTATGACAGTGTAAGTGATAGAATCTACTTCACAC
AAAATTTAGCCTCTGGAGTTGGACAGATTTCCTATGCCACCCTGTCTTCAGGGATCCATA
CTCCAACTGTCATTGCTTCAG
gtaagtgcactccaggtgctgcttgtcctgcaagtagacacaatggggtcaacacacatg
gatgactgagtgtttctaatgcatatgagactctaatgtctttgtgtgtgcttgtgtgtg
tgtctgcctgtatgtgtccaggtatagggactgctgatggcattgcctttgactggatta
EXON 40  166 bp
tgtcttcagggatccatactccaactgtcattgcttcaggtaagtgcactccaggtgctg
cttgtcctgcaagtagacacaatggggtcaacacacatggatgactgagtgtttctaatg
catatgagactctaatgtctttgtgtgtgcttgtgtgtgtgtctgcctgtatgtgtccag
GTATAGGGACTGCTGATGGCATTGCCTTTGACTGGATTACTAGAAGAATTTATTACAGTG
ACTACCTCAACCAGATGATTAATTCCATGGCTGAAGATGGGTCTAACCGCACTGTGATAG
CCCGCGTTCCAAAACCAAGAGCAATTGTGTTAGATCCCTGCCAAGG
gtatgccatcatcttccttgttatatttctgtctgcttatttctggaaaaaatggggcct
gaaattatgttcatagatagccaatgtgttatgggcttataaaactatggctacagattc
aaaaatgaaagcatattgagtgattttacgtgggaaggagggtgcagcgcatagctccct
EXON 41  159 bp
actaggaagtcaacaccctgacttactagatctcctttggacaagttgtgtaagtagaaa
tgaagtttcttttgccatgttactggcaatttgcaattaaagaatattgtcctttttttt
ttttttaaaggactatgaggttccctgtgaattaattattgactccttttgtatgactag
GTACCTGTACTGGGCTGACTGGGATACACATGCCAAAATCGAGAGAGCCACATTGGGAGG
AAACTTCCGCGTACCCATTGTGAACAGCAGTCTGGTCATGCCCAGTGGGCTGACTCTGGA
CTATGAAGAGGACCTTCTCTACTGGGTGGATGCTAGTCT
gtaggtgtctctggttactcatgtgggtgttaagaagaggtttttcttccatttccaaag
aagagggatttgcatcatgtgatgaaaatatagcatgccagatagacattgccagaatat
agaatcacagttttaggaactatgtttatattggaacttggtgaacatactgtgaaaatt
EXON 42  290 bp
ttgataagcaaacaagacctcccatcaccagaagaaacatttccagctgccatatgcccc
atttgaaaagaaagtttgcagcttgtgtaaacaatgatgaggcgcatgcattgggctgcc
agttgaaaacttaactcacttgagatttcaacttctaaatttttttttgcttcattttag
GCAGAGGATTGAACGCAGCACTCTGACGGGCGTGGATCGTGAAGTCATTGTCAATGCAGC
CGTTCATGCTTTTGGCTTGACTCTCTATGGCCAGTATATTTACTGGACTGACTTGTACAC
ACAAAGAATTTACCGAGCTAACAAATATGACGGGTCAGGTCAGATTGCAATGACCACAAA
TTTGCTCTCCCAGCCCAGGGGAATCAACACTGTTGTGAAGAACCAGAAACAACAGTGTAA
CAATCCTTGTGAACAGTTTAATGGGGGCTGCAGCCATATCTGTGCACCAG
gtaaggcactgaccatgaaaattagaacatggagaataatgatcacaataccaattggta
aggaaagctgaagttctcacaggagaaaaaattcaaattctccttgatgtcagggtaatt
tatgaaacagacctggggctatattttgagaggaagacttggcaggcttcttttctaatc
EXON 43  204 bp
attgctcttcttgatggaaaagtgactcagaatatagttaaaaggttaatgggcagaact
tccatggcgcttcttagggagcatttaatgtagaagctgttgcaagtgctattgtggagg
ggtcaatgtgaacggtggctgcatccatcttttacttcttctgggattatctttcttcag
GTCCAAATGGTGCCGAGTGCCAGTGTCCACATGAGGGCAACTGGTATTTGGCCAACAACA
GGAAGCACTGCATTGTGGACAATGGTGAACGATGTGGTGCATCTTCCTTCACCTGCTCCA
ATGGGCGCTGCATCTCGGAAGAGTGGAAGTGTGATAATGACAACGACTGTGGGGATGGCA
GTGATGAGATGGAAAGTGTCTGTG
gtgagttggactcttggcgcttttggtaggagctaatggcatcttgatgtcaagtgtttg
gtatggaatcctgctatgtgtgaatgtgtttgaaatgtgtgcctaggcatcctggtagag
ctgaaaaatgtttcctctgataatccagactgtttctgttaaatcacctctgtagtggtt
EXON 44  243 bp
atattttgcttaatctaactaattaaaagtgttatctcactttgcatgcagtccattttg
cagcgttttttgccttggaaggtaaattcaaagtgtctcttttatttaattgtatctttt
taaaaattaggataatgttttaatcaagagggtttgttctcatgtttttcctgttcttag
CACTTCACACCTGCTCACCGACAGCCTTCACCTGTGCCAATGGGCGATGTGTCCAATACT
CTTACCGCTGTGATTACTACAATGACTGTGGTGATGGCAGTGATGAGGCAGGGTGCCTGT
TCAGGGACTGCAATGCCACCACGGAGTTTATGTGCAATAACAGAAGGTGCATACCTCGTG
AGTTTATCTGCAATGGTGTAGACAACTGCCATGATAATAACACTTCAGATGAGAAAAATT
GCC
gtaagtttatcttaagtgcttattgtgattttgggtctgaagtcttggatcacaggagat
gaaattattatataaaaaaaaggctttccaaaaataaaaaccctaagtatttatctaaaa
cgtaaatttttggctaggcgcggtagcaagtatcaacaaataccaatcttgtttcatttt
EXON 45  123 bp
tttttttactacagaatctataggtaacataagtatcatggatcctgcctttctgatggc
tttgaaaatgccgcccttccagtggtttgagttccacaatagatgtgttagcacggatac
tgttcataatacatatttggtggatatattcctaatatttatctggttgtctttttcaag
CTGATCGCACTTGCCAGTCTGGATACACAAAATGTCATAATTCAAATATTTGTATTCCTC
GCGTTTATTTGTGTGACGGAGACAATGACTGTGGAGATAACAGTGATGAAAACCCTACTT
ATT
gcagtgagtaagataaaactgctttctttctatcgttccagagatgcatgttgtgagcta
atacaaagatatgaagcgtgggtattcgggctgatttcaattgtcatttcacattgacct
tctaagtagaggtggtaggcagttgctttcatatgtgattgcaggggtatgagaaactct
EXON 46  124 bp
gacttccttctgtctcccatacttcttcctccccacagaaagcttacacaagcatccatt
ttccaggctcagtcttccttttttggtaactattatctagctcagagatagaggcagatt
gttaagactgatgggaacatgcttgtgttttgctcatgggttttatcttctttccctcct
GCAGCCACTCACACGTGCAGCAGCAGTGAGTTCCAATGCGCATCTGGGCGCTGTATTCCT
CAACATTGGTATTGTGATCAAGAAACAGATTGTTTTGATGCCTCTGATGAACCTGCCTCT
TGTG
gtaagagagtaagcaagcatgaaaaacatcacgatgcagctagacaacttcagtctcttc
caactgcttcaaatacagaccagggtcatggctgctgaatgcttggacttcctgtcccag
ctttcatctggaatgctgacaccgctcagcggatattcattaagacctgttagtggagag
EXON 47  132 bp
cttttacctcaaactgttggtcgctggtactagtcttattggaggactaccctagatgta
tataattaaataatgctctgtttcaggttttctagacaacccatgctacaaccagcttgt
ctccagattcctggactgtaaaccactttttttcactgagaatgctattgatcttttcag
GTCACTCTGAGCGAACATGCCTAGCTGATGAGTTCAAGTGTGATGGTGGGAGGTGCATCC
CAAGCGAATGGATCTGTGACGGTGATAATGACTGTGGGGATATGAGTGACGAGGATAAAA
GGCACCAGTGTC
gtaagtgaagccaattaattcctctgcagagtcacattccagggaaacacagtagagttg
tttttctgtgtttggagagtatgattgcagatttctctgtaattgaatggacactgatag
aatgttacctttgtttctccatgctgggagtgtttgatatcatccacttaaatgcttcag
EXON 48  202 bp
aaatggaatctttggaggtatttttattatgatctattattataatagcagtgtaatttg
tctacgtgttttcctcccatttcctttcatacttagaatggtaagtaacattaaagcaaa
gagaattaactgctgcactgagctctcatgctttctgattcttgcgtgctttggtttcag
AGAATCAAAACTGCTCGGATTCCGAGTTTCTCTGTGTAAATGACAGACCTCCGGACAGGA
GGTGCATTCCCCAGTCTTGGGTCTGTGATGGCGATGTGGATTGTACTGACGGCTACGATG
AGAATCAGAATTGCACCAGGAGAACTTGCTCTGAAAATGAATTCACCTGTGGTTACGGAC
TGTGTATCCCAAAGATATTCAG
gtgaattgaggattcagaagttacccagcatgcctcaaatgtccatgggggctgggctca
cttacctatcaggcaccccgtggccacagtgcccagggcccatgatgcttttagtggctt
atgaaaatgtttggattcctttccaaatcaaagggaaaaaaaacttttacatcaaagaaa
EXON 49  296 bp
ttggcgattagtggggtagacgaagatgatgggggaaaggggatcaaggacactggtgat
cttgtcgaaatggttgacctggcatttaggtagataaagaaggaagcaaaaccccaagtg
ggtaatagttgaggtttattgccaacctctctgaaagtggtactggatctcatgatacag
GTGTGACCGGCACAATGACTGTGGTGACTATAGCGACGAGAGGGGCTGCTTATACCAGAC
TTGCCAACAGAATCAGTTTACCTGTCAGAACGGGCGCTGCATTAGTAAAACCTTCGTCTG
TGATGAGGATAATGACTGTGGAGACGGATCTGATGAGCTGATGCACCTGTGCCACACCCC
AGAACCCACGTGTCCACCTCACGAGTTCAAGTGTGACAATGGGCGCTGCATCGAGATGAT
GAAACTCTGCAACCACCTAGATGACTGTTTGGACAACAGCGATGAGAAAGGCTGTG
gtgagtacaacagaggatttgggaaaaggaaacaggggagactgaatatggattctcaac
ccttcacgacttagactttccaacctgtcctctaactacaaagttaccataaaatcacta
ttcctgatatagcaaaaggttaccaaagtttcttggtatataagatggggacacacattt
EXON 50  517 bp
gtgaggaagttgaaaaatagtgacttttcaataatccacagtctttggaagtctttgttg
tctgtcttagcatgattcattaagaattggcactgtttagtagaaatgttgactttgaac
cattatagtgagttggtcgttgatattttaggatctctaagaactgctttttacctacag
GCATTAATGAATGCCATGACCCTTCAATCAGTGGCTGCGATCACAACTGCACAGACACCT
TAACCAGTTTCTATTGTTCCTGTCGTCCTGGTTACAAGCTCATGTCTGACAAGCGGACTT
GTGTTGATATTGATGAATGCACAGAGATGCCTTTTGTCTGTAGCCAGAAGTGTGAGAATG
TAATAGGCTCCTACATCTGTAAGTGTGCCCCAGGCTACCTCCGAGAACCAGATGGAAAGA
CCTGCCGGCAAAACAGTAACATCGAACCCTATCTCATTTTTAGCAACCGTTACTATTTGA
GAAATTTAACTATAGATGGCTATTTTTACTCCCTCATCTTGGAAGGACTGGACAATGTTG
TGGCATTAGATTTTGACCGAGTAGAGAAGAGATTGTATTGGATTGATACACAGAGGCAAG
TCATTGAGAGAATGTTTCTGAATAAGACAAACAAGGAGACAATCATAAACCACAGACTAC
CAGCTGCAGAAAGTCTGGCTGTAGACTGGGTTTCCAG
gtaagaaaacactgatgagctttttaaaagttaaaaattaaaaaattctaaccatgtttt
catcttgataggaaattaatttttcaacttgggttaatatgcagatacatttaatgtttc
tgcaggtttattttctgctttgtatctgatattcaaatgatagattcagaacagaatatc
EXON 51  153 bp
ctgttgcctcactgcaggaagacaaacttcctgttttcccctgccctcatttgcctgaag
aaaggtgacttctaacaactgtctgtgattctcaggtagcttgggtaggaaactgggtgg
ctaaatatgtaccatttcacaaagtgactgtattggttaactcctggctctccattttag
AAAGCTCTACTGGTTGGATGCCCGCCTGGATGGCCTCTTTGTCTCTGACCTCAATGGTGG
ACACCGCCGCATGCTGGCCCAGCACTGTGTGGATGCCAACAACACCTTCTGCTTTGATAA
TCCCAGAGGACTTGCCCTTCACCCTCAATATGG
gtattgtctccctgcaatcctgggcttttctttcacctccttcttctgcctctgttaccg
agaaggctgttcatgtaactatctcaaggccaatgtcttgctggggtttgtcttctgctt
ttcctacttggtaaattgtttagtgtaatgagtagaagcatggcttcttcaaatcatcat
EXON 52  171 bp
ttttcttttttagattatttgctgttagctctctttcttttctgaatgcagaaaagaatt
cagaatgcagtctgctctacagaatgcagactccatttctctaaatggagaaaaggtgtg
tattttggctactgacttcttttggcatcagggactgaccctttgtgtttgccctgacag
GTACCTCTACTGGGCAGACTGGGGTCACCGCGCATACATTGGGAGAGTAGGCATGGATGG
AACCAACAAGTCTGTGATAATCTCCACCAAGTTAGAGTGGCCTAATGGCATCACCATTGA
TTACACCAATGATCTACTCTACTGGGCAGATGCCCACCTGGGTTACATAGA
gtacgtacatagaaaagcataaaacaattgtgtaactgtttatttcaaacatcagagctt
gtgattccagtctattagtcccctctattgtctaactggcctgtctgttggaagtcattc
gggggaagtcacacttctaactaaaactgctgagctctatggtatggtgcagtagaaaga
EXON 53  224 bp
tttgaattcatcctttaagtttaatttttgttttaattaaagactaggagttttgaggat
ctgaacttatattatctctaggaggtagaattttattgatttgtgaattcttttatcctg
caagacattagaggagaggaattacctttatcacataactgtttctgcttactgctgcag
GTACTCTGATTTGGAGGGCCACCATCGACACACGGTGTATGATGGGGCACTGCCTCACCC
TTTCGCTATTACCATTTTTGAAGACACTATTTATTGGACAGATTGGAATACAAGGACAGT
GGAAAAGGGAAACAAATATGATGGATCAAATAGACAGACACTGGTGAACACAACACACAG
ACCATTTGACATCCATGTGTACCATCCATATAGGCAGCCCATTG
gtgagtaggtgattgaggggtttggcaaggttgccttgggttatgtgcatgtcatgattg
tctttaagcatgaacttcgtgatttacaaaaagtttgttgcacttgttagtgttttcttc
aaagcatatgctgaaagttgacagtaggcaaatatctttagagtttatcccccttcccct
EXON 54  178 bp
tgttgcttgtataactctatcatctgttttatttaggaacttttgggaaaatcataaatc
taggatagttttttttttactaagaggtgatgagtttaaagtcaagatgtgtaatcagct
aatctgtgcttgatactctctttcagcaaatgaacacatattttcttccttttccactag
TGAGCAATCCCTGTGGTACCAACAATGGTGGCTGTTCTCATCTCTGCCTCATCAAGCCAG
GAGGAAAAGGGTTCACTTGCGAGTGTCCAGATGACTTCCGCACCCTTCAGCTGAGTGGCA
GCACCTACTGCATGCCCATGTGCTCCAGCACCCAGTTCCTGTGCGCTAACAATGAAAA
gtaaggctctctttcccctctcctcagtgcctctctagcccgtggacagacattgacctt
caaggctccaagggatgggagttttctagtgagacaagattttggttaattaacttggtt
catgtggaacacagcaagactctcagcctccaacttcagataatattttccatgaataga
EXON 55  197 bp
ttgccaagttatgttttctctgaaaatacaccattgtaactgagatttaattgatcctct
tctagggccacgagagagctcatgcatgtcatttcttggaattcagtgttgacttcttct
ctccagataactgttgcccctggtgctttgctaaagaagtgctgtatgttctctgtgcag
GTGCATTCCTATCTGGTGGAAATGTGATGGACAGAAAGACTGCTCAGATGGCTCTGATGA
ACTGGCCCTTTGCCCGCAGCGCTTCTGCCGACTGGGACAGTTCCAGTGCAGTGACGGCAA
CTGCACCAGCCCGCAGACTTTATGCAATGCTCACCAAAATTGCCCTGATGGGTCTGATGA
AGACCGTCTTCTTTGTG
gtgtgttgagtcgctttatgcctctttttccgacttctatgttgattgtatacgatcatg
attctgtgggtatttcctgaatatcatgaactaaaaaccagttcaaagtcctagaaggaa
actcaggctccatcctttttctatttttatgaagtttttttttttttttttttagaaatc
EXON 56  246 bp
ggagacagtaatagtcaaaagaagaagtgctccatgtagtagtactgactgataagtaca
ttaggaaataagtcctctaaaaagaaatcatgatcctgctatccaggattcactgatgtc
aattaggagctttcattcttgatgccttccaagctgataaccaaatgtccctgctctcag
AGAATCACCACTGTGACTCCAATGAATGGCAGTGCGCCAACAAACGTTGCATCCCAGAAT
CCTGGCAGTGTGACACATTTAACGACTGTGAGGATAACTCAGATGAAGACAGTTCCCACT
GTGCCAGCAGGACCTGCCGGCCGGGCCAGTTTCGGTGTGCTAATGGCCGCTGCATCCCGC
AGGCCTGGAAGTGTGATGTGGATAATGATTGTGGAGACCACTCGGATGAGCCCATTGAAG
AATGCA
gtaagttcctgtgggaggaccaaggcatgaccagagcagggagacacgaggaaacttcca
tggggactgagagaggacatggagctttctttttcagctgatgggatgctcccccttggc
actccctgcaaactctggcactgcaaggcagagtatagctgtgtggcttgcaggtggaac
EXON 57  129 bp
ttaggactatttttctgctcatggtaaacagatcacatctaaaacagacacatatcgcca
gaggcggtttgcttggtaacatggtcattgttattcctcagtaccacaacctcaatgtga
caatggaaaggtgctttcttgtaccttcagttctgactttgatgcctcctcccttttcag
TGAGCTCTGCCCATCTCTGTGACAACTTCACAGAATTCAGCTGCAAAACAAATTACCGCT
GCATCCCAAAGTGGGCCGTGTGCAATGGTGTAGATGACTGCAGGGACAACAGTGATGAGC
AAGGCTGTG
gtaggaggggccacaggggagtggagggagggacaagaaagtgcacatgtcaagtgccat
ttattagatgagagatgagagtgtatttcccatgtcatcttttctttgtttacctctgta
aaaaaatggttgattcttctaataacatgttacatttttgtagcattttgcagggttacc
EXON 58  120 bp
gataggctcagggtagctaaaagagggaatgttgaccatgaatgttgctggcattcctct
ctttgggagcttcaagagtgagctaatacaattctcagactgtctcacaaggaagccaat
actactttgtgcatttctctgccaatggtttatgaagtctttgcaatgactgctttgcag
AGGAGAGGACATGCCATCCTGTGGGGGATTTCCGCTGTAAAAATCACCACTGCATCCCTC
TTCGTTGGCAGTGTGATGGGCAAAATGACTGTGGAGATAACTCAGATGAGGAAAACTGTG

gtgagtgttcacagtcctatggtccttatataccaccagagctgtgatgtttgctttttg
tccataattcaactgtctatgtcattgatcctcaatgggtaggatgatatcaagctgtct
gatctctttctttctgctggtcagtacatttctactttctcttccactaaagacataagc
EXON 59  117 bp
cagactcaaaattaaggtgaaaggtctagttttggagggtgaatgatttgcccaagcaca
cctctggggcttgggacacaggagggtgctgggcacccagggcactatggtcagctcaca
agatgtctcctgtatgtgattcctggtgcacactcatggccaggtgcctttcctttccag
CTCCCCGGGAGTGCACAGAGAGCGAGTTTCGATGTGTCAATCAGCAGTGCATTCCCTCGC
GATGGATCTGTGACCATTACAACGACTGTGGGGACAACTCAGATGAACGGGACTGTG
gtaactgtcatttgagaagcttaccatagaattttgtactgtgacagtgtaggggcttca
aattagtgtttataaggcttttagaggaaaattatttttgtatatgtgtaatatgtaaac
cttagcataacacagtatcttctgctctgtattttctatgcattattcttaactcatagc
EXON 60  117 bp
gagtggggaaagtgtgagttttgagaatgtattaatttgctaaccacaagttgtgggttt
gctgtgagccagtcacagggtgtagataggaatgtgatggagtaaccactatactccagg
tacctaatatctgtctgaaaatgacaaggccttctcggaatgacaatcttttctcttcag
AGATGAGGACCTGCCATCCTGAATATTTTCAGTGTACAAGTGGACATTGTGTACACAGTG
AACTGAAATGCGATGGATCCGCTGACTGTTTGGATGCGTCTGATGAAGCTGATTGTC
gtaagtccctagacacatatgtagtactgcttacctgagagcatggatatgatagtttag
acatcagtccgctgccgcttcttagattaaaaggccataagtattgtctgttcagcatgc
actgataatgatcagttcacctgagttctaagtcatcataatcatacatttcacaatggc
EXON 61  138 bp
tgacaactgcccttaagacatagtccgttcaactttcagacaggtcaaggccactataca
tcttgatgaataaagaagagcaggctataatggcaagagccaaaggagaaatagcaggaa
gcttccccaaagtagtcaatttgtataataatttgaatatgtttttttcccccatggcag
CCACACGCTTTCCTGATGGTGCATACTGCCAGGCTACTATGTTCGAATGCAAAAACCATG
TTTGTATCCCGCCATATTGGAAATGTGATGGCGATGATGACTGTGGCGATGGTTCAGATG
AAGAACTTCACCTGTGCT
gtaagagggagagaaacggagtgaatgggagtggtgttgtctgtcaaatctcattgtttc
ttacgtgtagcatgtgagcctggagagcagttgtacaattgtttaggaatggacacagga
tcagcgttggtgttatttcactgggtcttccagcttcagttctctctgtaacctgagaaa
EXON 62  123 bp
gcctagcacagtgccttggtgtgtactatacatgtaaggtgtatctgctgattgattaat
caaatgagtaaatgagtgcatgaatgaagcaagcctggtgctgacactggagtattttag
atattgacacttagattctactgttaacttgtaatttcatttttctatctttcctttcag
TGGATGTTCCCTGTAATTCACCAAACCGTTTCCGGTGTGACAACAATCGCTGCATTTATA
GTCATGAGGTGTGCAATGGTGTGGATGACTGTGGAGATGGAACTGATGAGACAGAGGAGC
ACT
gtaagcaaaagtcaaaagggagaaggaaaaaggaaggaccccaagtggtctgcagtttgg
aaaatgtgcctctgggatttcagtttgttctatagagttgtgcccatgactgcagatctc
tgctgacataattgtttacaagaccatgcaaacacatgcattgcttacatgtaaccctgc
EXON 63  129 bp
tccaactgacagtacgttggctagaactggtcacatggtcctaacccagctgcaagggag
actgggaaatgtagggaagcacttgtttatttggtaagcacaaactgtctctgtcaaaga
aggaagtatcttgcttcataaaagaaaaagttttgattttaacttgtttttacattgcag
GTAGAAAACCGACCCCTAAACCTTGTACAGAATATGAATATAAGTGTGGCAATGGGCATT
GCATTCCACATGACAATGTGTGTGATGATGCCGATGACTGTGGTGACTGGTCCGATGAAC
TGGGTTGCA
gtaagtaaacacttgtttttatagttcattgtagtaactcaggtttacctaattaaaaca
tgcaataacataatgtagacactgaccacattttctccttaatgtactttttgcttgaat
tccagtcaagcccatagctagctgtgactgagtgcttatcctagaccagacattgtgtca
EXON 64  132 bp
atcacgatcagaaataggaatcctgactcccccagtgccctctgtcctctccaaggctta
tggaaaggggttatctcaagatgtcctatagttggttacgagtaggtgcttcttttgata
caccacttgactgttatttgtggctgatctggtttgtaatgctgggattttgtttttcag
ATAAAGGAAAAGAAAGAACATGTGCTGAAAATATATGCGAGCAAAATTGTACCCAATTAA
ATGAAGGAGGATTTATCTGCTCCTGTACAGCTGGGTTCGAAACCAATGTTTTTGACAGAA
CCTCCTGTCTAG
gtagagtatattttttccaattcctgtttaggtgaactttacatctaaggttctccaccc
actcccctttgttaaataaatcactatttaattcccttaatggtaccatactcatggttt
catggttctaggtcattaaactactcaagaattgctttcccccacctgcatgcatgctat
EXON 65  132 bp
tgaaaagcatgtgaaacagtatctgaaacttagtgtttcacaaatgtttgtatcattgct
tattttcatctgtacccttctcggtcctcattgctggtgaatatgggtttaaacagaagc
aagatctctaaggaatggatgggaacagatgttgcgtatttggttttattttgcctacag
ATATCAATGAATGTGAACAATTTGGGACTTGTCCCCAGCACTGCAGAAATACCAAAGGAA
GTTATGAGTGTGTCTGTGCTGATGGCTTCACGTCTATGAGTGACCGCCCTGGAAAACGAT
GTGCAGCTGAGG
gtatgatgggttcatgttgggattaattgacttttggggaaataaatactgctaagtaca
ctatacgatgaaagaaacttcagcttctcatagtttttcttttctttctttttttttaaa
ctcgccagctgcttctcttccaacacctctttagtcgctccttctctctcctcccctgcc
EXON 66  144 bp
agtcacggattttgtaacccagttggagagtcagctttattgattaacagagatagtcag
attcctataaaaactcatgttctttaaaaaggggacaggtacatactgtgcattttatat
cctactttatataggaaagtataattcaaacagataaagtagccctttgtttgtttacag
GTAGCTCTCCTTTGTTGCTACTGCCTGACAATGTCCGAATTCGAAAATATAATCTCTCAT
CTGAGAGGTTCTCAGAGTATCTTCAAGATGAGGAATATATCCAAGCTGTTGATTATGATT
GGGATCCCAAGGACATAGGCCTCA
gtgagtataaactttggcatctttcattgatattaagtgactttatagaattttaaggtg
ttgacttttaaggaatttattgtttaatgagtgaattttgttgcattagtggaggaggaa
actcttccaatccagcatgctcctgatgccttagcgtggccttgaatcccagccaagctt
EXON 67  166 bp
aagtttgataggttttaaagtttgattatactgatgtcattgaattattcatattataac
aacagtgaggagggaggtagagatgtcaataaacgaacagtacttcacctgattagaccc
ctgttcttcctttacttgatgctcttgacatgaaactgacctgtgtgtcttcctctgtag
GTGTTGTGTATTACACTGTGCGAGGGGAGGGCTCTAGGTTTGGTGCTATCAAACGTGCCT
ACATCCCCAACTTTGAATCCGGCCGCAATAATCTTGTGCAGGAAGTTGACCTGAAACTGA
AATACGTAATGCAGCCAGATGGAATAGCAGTGGACTGGGTTGGAAG
gtaaatttgccatacattccccccttacctgttctgttttcctggttagagttctctact
gcactccatgggccatgagtgagtctgggcctggatatgagtacactcagccatgggtgc
agctgggcagtggttgggcttgctgaagccccagcaactacctccacttaccccagcatg
EXON 68  129 bp
aacctgccaaacatgtccccttggctgtagttcccccaagagagggggactatggtctga
tgataggtatctgagcagctgtctcaccagccaaacgaaatgctctcatcttcaaacctc
ttacccagtaatgattactctaggctttgcagttgtttaactttgtccctctgaattcag
GCATATTTACTGGTCAGATGTCAAGAATAAACGCATTGAGGTGGCTAAACTTGATGGAAG
GTACAGAAAGTGGCTGATTTCCACTGACCTGGACCAACCAGCTGCTATTGCTGTGAATCC
CAAACTAGG
gtaagtacttggagaagtcttcaacatctagatatttctccctggattctcatcaaattc
catgtttcttataatttttttttcctagtttaactgaaattgtccttcaagtttttggga
gtagcgtctatgactgtttcaagaattataacatgcccttgagatcatatagaaccaacc
EXON 69  221 bp
atgtgctcttgcgcccctatttttgctccccatcttctgtaaaatataaaactggtgtca
ctgagcacccaggtccctgagataaacagttggtttccctgtaggtaatgccctgtgctc
tgctgtagtggagaagtcttaccaggtgagatgctacagtgaagaaatcttctgttatag
GCTTATGTTCTGGACTGACTGGGGAAAGGAACCTAAAATCGAGTCTGCCTGGATGAATGG
AGAGGACCGCAACATCCTGGTTTTCGAGGACCTTGGTTGGCCAACTGGCCTTTCTATCGA
TTATTTGAACAATGACCGAATCTACTGGAGTGACTTCAAGGAGGACGTTATTGAAACCAT
AAAATATGATGGGACTGATAGGAGAGTCATTGCAAAGGAAG
gttagaaattagttagaaagtaatatattaaattaataattaacatatttctaatgtctt
tgcctgttttctcaagaaggagccctgctcttaggaaatggcttatatagttttttagat
accacccctccacccccaccaactcccacctgctgaattaaatgcagatgagttcattag
EXON 70  177 bp
gcagcacactttcacagtcccatgtagctaaagtcagcctgaatattcccagagcttcaa
ggcattgtatgagggaataattcaagcagaatgacatcagatctagaagtggcggtaggg
tgtagtgggtattttcttttcaataaccttctgttttgtttttcccctgtgggtaagcag
CAATGAACCCTTACAGCCTGGACATCTTTGAAGACCAGTTATACTGGATATCTAAGGAAA
AGGGAGAAGTATGGAAACAAAATAAATTTGGGCAAGGAAAGAAAGAGAAAACGCTGGTAG
TGAACCCTTGGCTCACTCAAGTTCGAATCTTTCATCAACTCAGATACAATAAGTCAG
gtaatcaccaactttggtataagatgctcctcattacttggaaatcttatttcaaaataa
tggctatattgctggaagatggcagtagataacaacaagctaatctcttggtgcatgaaa
ggggtatatgtgtatgtacgtttgctgggggagaggaacgttttaaccattttcaccaaa
EXON 71  120 bp
tgcagtgtggtggcagagatgatagtgtaaatgagggtgagtggccagctgacacgtgga
cgagaggtattgagaggatgcctaggctctgctgtcacctggcagagccacttccagttg
ctgggtattcaggttattcattctgtcaggacctaactgctgttctcacccgctttccag
TGCCCAACCTTTGCAAACAGATCTGCAGCCACCTCTGCCTTCTGAGACCTGGAGGATACA
GCTGTGCCTGTCCCCAAGGCTCCAGCTTTATAGAGGGGAGCACCACTGAGTGTGATGCAG

gtaggagcactgcccaagcagctatgggggcctgggagcactcctctgctgccttcagga
gtcagaagaatccctgtatgctgggtcctttgcagcagagtggggatggctggaaggagg
gttaagggatgtgggaggtatgaacagagttgagtgggacttagggggcaaacagaactg
EXON 72  91 bp
tatgttactctccaagaccttaaggaaactcactggacttagggggaaggtaagctttga
cagggagactaattggctggcctgcccctcctcccacccctaacctgggccggtttgcat
ggtgtgggcactctgctgagtacagctgactaacacctgcatggctttcccttcctgcag
CCATCGAACTGCCTATCAACCTGCCCCCCCCATGCAGGTGCATGCACGGAGGAAATTGCT
ATTTTGATGAGACTGACCTCCCCAAATGCAA
gtaagtctgaatgttgaggtcccagctataggccttgcctcttctggggaaatttgagac
cttaaagtagccaggaaaacaaatacaggaacctcaccagttcactaattcttacatttt
aaccagcttgccttcccttgagggagtctacagagaactgaggcagtgcttctttaacta
EXON 73  68 bp
gcactgttctttctgcttgtcttctcttggcagaatgaacaaaagtcatgcaggatacat
tgtctgttcaacatgtaatttatgcagtcaaagctctctctacttcaggatgtgctcaga
aaaatgcagtagaagcctaagaacataacagctagtgaatgatttgctttttcctttcag
GTGTCCTAGCGGCTACACCGGAAAATATTGTGAAATGGCGTTTTCAAAAGGCATCTCTCC
AGGAACAA
gtaagttttaagaatgtgagcaacttggaaattactcatggcccctacattgaatgctgt
cacagcttttctacttaacccagtctttgaaggagtggttctagcccccagtttctgcca
ggattgcgggctcccatgtgttgatgtgctctctgctatcttcttctatagccgcagtag
EXON 74  121 bp
caggaacaagtaagttttaagaatgtgagcaacttggaaattactcatggcccctacatt
gaatgctgtcacagcttttctacttaacccagtctttgaaggagtggttctagcccccag
tttctgccaggattgcgggctcccatgtgttgatgtgctctctgctatcttcttctatag
CCGCAGTAGCTGTGCTGTTGACAATCCTCTTGATCGTCGTAATTGGAGCTCTGGCAATTG
CAGGATTCTTCCACTATAGAAGGACCGGCTCCCTTTTGCCTGCTCTGCCCAAGCTGCCAA
G
gtcagtttcattatggggaacgttgatgtttgaagcctaagaaattcatatgaagccatg
tgaaggacttagttttctttctaagttaaaaaagcacaatacgcagttcaccgattccac
agaaacaaaaagtagtgaggatgtaaagcagtcacttcaaatcccaacttcttagtcaag
EXON 75  130 bp
ggtagctaagggaacttactaccatatttgacagtgtaaatttagagtgggaattgagca
ttacatttgaggaagatttggcaatgtggaggagagggtactattgtgaaaggttgtatt
tgttgtttttgttgttgttgttttaaataacaagacactgttttggttacttctttccag
CTTAAGCAGTCTCGTCAAGCCCTCTGAAAATGGGAATGGGGTGACCTTCAGATCAGGGGC
AGATCTTAACATGGATATTGGAGTGTCTGGTTTTGGACCTGAGACTGCTATTGACAGGTC
AATGGCAATG
gtgagtatggtttcaaaatgattatttgaaggttgtcatttatagaataaatacttttta
taaagaacaaaattcacctagagaagactgaaatacagtattaggcctctcagaataagg
tctgcactacacaagttaggaaacattaggtttgttgctgaaaggtgtctaaaaacattg
EXON 76  102 bp
tggcctttttttttttttttttttgcaagttctcttttgggtaacttatgacgtagcacc
tagcgtacctccaggtgtgaggaaggcacctttctttgtgtgtgaaccagattagtatgg
tgtaatctctctctctgtttctctctctctctctctctctctttctgtctctgccatcag
AGTGAAGACTTTGTCATGGAAATGGGGAAGCAGCCCATAATATTTGAAAACCCAATGTAC
TCAGCCAGAGACAGTGCTGTCAAAGTGGTTCAGCCAATCCAG
gtgagaaaccatacagtcttttctttcagttactgctgtcgctggatcttaatctattga
gtcatgtcttaggattttcctaaccttccctccaaagggaaggaagcatagtgagtggtc
catgctgcagctgccctatctgcaggaacaggaccaacccaaggacataagacctgaaaa
EXON 77  108 bp
ggggcggtgggagtgatgtttagtcctggcctactgggtcatgcaataaaaatggtgcct
gatgatgtctgtgggagaacaagatggcaaaaagagccagagttggtacaaactttacag
caaatttatttactactaaattctttcaaaattgggtaaaggcctttaacatgtccacag
GTGACTGTATCTGAAAATGTGGATAATAAGAATTATGGAAGTCCCATAAACCCTTCTGAG
ATAGTTCCAGAGACAAACCCAACTTCACCAGCTGCTGATGGAACTCAG
gtaacagttgccgactcctgaaataatgtgggatttggaaaaactttgggatgactgggt
ttttattaaccttaagcaaacaagggagattctggaaggctcaaagatctcaagatgtgt
tgacagttaataaatataattttttaaaaagtcatagattgaaaaactttccaccaaata
EXON 78  72 bp
actgttcagggaccataggaggaattgaacaatttaccatatgggctgaatcacatggtc
ccaggtcccaaattgctttacccttcagtaagaagaaattttaaaactgagacaggagga
aaagaaacccacaaaataattccattactgagaggtttttgttttccccttttcatttag
GTGACAAAATGGAATCTCTTCAAACGAAAATCTAAACAAACTACCAACTTTGAAAATCCA
ATCTATGCACAG
gtaatttttaacaatttttcttagcacagacattttttcttagaaattatttgcttggtt
aaattggacacacacttagattattctgagcagagtggccacaaatagtcttctttatga
aaaaccgtgtatggtgaccttgggggaataaatggctgattcctgttacattgtattctt
EXON 79  480 bp
aatttttaacaatttttcttagcacagacattttttcttagaaattatttgcttggttaa
attggacacacacttagattattctgagcagagtggccacaaatagtcttctttatgaaa
aaccgtgtatggtgaccttgggggaataaatggctgattcctgttacattgtattcttag
ATGGAGAACGAGCAAAAGGAAAGTGTTGCTGCGACACCACCTCCATCACCTTCGCTCCCT
GCTAAGCCTAAGCCTCCTTCGAGAAGAGACCCAACTCCAACCTATTCTGCAACAGAAGAC
ACTTTTAAAGACACCGCAAATCTTGTTAAAGAAGACTCTGAAGTATAGCTATACCAGCTA
TTTAGGGAATAATTAGAAACACACTTTTGCACATATATTTTTTACAAACAGATGAAAAAA
GTTAACATTCAGTACTTTATGAAAAAAATATATTTTTCCCTGTTTGCCTATAGTTGGAGG
TATCCTGTGTGTCTTTTTTTACTTATGCCGTCTCATATTTTTACAAATAATTATCACAAT
GTACTATATGTATATCTTTGCACTGAAGTTGTCTGAAGGTAATACTATAAATATATTGTA
TATTTGTAAATTTTGGAAAGATTATCCTGTTACTGAATTTGCTAATAAAGATGTCTGCTG

atttggttggtgatcattatagtaaatgatccaacaagaaaaggaattgactggggacct
ttagccgtgtctaaagaagaggcaccactcatatttcctataaaattatctaggaaagga
atccaggccccgctcttgggtccatttttacacattagcacttaattaatgttcaatatt