Gene KIF3C Variant 1
DNA : 55.47 KbNT_022184
mRNA : 4914 bp NM_002254
CDS : 2381 bp NP_002245
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  1698 bp
gttgccgaagctgtttacggcagcgctccctctgctcctgcatggggcgggctccgggca
cggctgctcggcaggcgctgctcccgcggcgactgggggattctgcctaattcacctccc
agccggtgcagagaggaccggagagcggtggaggcccggactgcagcagcgttggggcca
CCTCCCAGCGTCCCCACCCTAGGAGGCTGCATGCGGATTGAAGAGCTGCGCCTGGGGGCT
GGGCCGGCCCCGCTGATCCCGACCTAGCGAGCAGGATAGCAGGACCGCCCAGGCTGCGGA
GGGGCTCGGGGGCAGGAAGGTCAGAGCAGCAAGATGGCCAGTAAGACCAAGGCCAGCGAG
GCCCTCAAGGTGGTGGCCCGGTGCCGCCCCCTCAGCAGGAAGGAGGAGGCTGCTGGTCAC
GAGCAGATCCTGACCATGGACGTGAAACTGGGCCAGGTGACCCTGCGGAACCCCCGCGCC
GCCCCGGGGGAGCTGCCCAAGACCTTCACCTTTGACGCCGTGTATGATGCCAGCTCCAAG
CAGGCCGACCTGTATGACGAAACCGTGAGGCCCCTGATAGACTCCGTGCTCCAGGGTTTC
AATGGCACGGTGTTTGCCTATGGCCAGACGGGCACTGGCAAGACCTATACCATGCAGGGG
ACCTGGGTGGAGCCCGAGCTGCGCGGGGTCATCCCGAATGCCTTTGAGCACATCTTCACC
CACATCTCCCGCTCCCAGAACCAACAGTACCTGGTCCGGGCCTCCTATTTGGAGATCTAC
CAGGAAGAGATTCGAGACCTGCTCTCCAAGGAGCCGGGCAAGAGGCTAGAGCTGAAAGAG
AACCCCGAGACTGGCGTCTACATCAAGGACCTCTCCTCCTTCGTCACCAAGAATGTCAAG
GAGATTGAGCATGTGATGAACCTGGGGAACCAGACCCGGGCTGTGGGCAGCACCCACATG
AATGAGGTCAGCTCCCGCTCCCATGCCATCTTCATCATCACTGTGGAGTGCAGCGAACGT
GGCTCTGATGGCCAGGACCACATCCGAGTGGGCAAGCTCAACCTCGTGGACCTGGCTGGC
AGCGAGAGGCAGAACAAGGCAGGCCCCAACACAGCGGGAGGGGCAGCCACACCATCCTCG
GGTGGCGGTGGTGGCGGTGGAGGCAGTGGTGGTGGTGCTGGTGGAGAGAGGCCTAAGGAA
GCCTCCAAAATCAACCTCTCATTATCTGCCCTGGGCAACGTGATTGCTGCCCTGGCGGGC
AACAGGAGCACCCACATTCCCTACCGGGACTCCAAGCTGACCCGGCTGCTCCAGGACTCC
CTGGGGGGGAATGCCAAGACCATCATGGTAGCCACACTGGGGCCAGCTTCTCACAGCTAC
GATGAGAGCCTCTCCACCTTGCGCTTTGCCAACCGAGCCAAGAACATCAAGAACAAGCCC
CAGGTGAACGAGGACCCCAAGGACACACTGCTGCGGGAATTCCAAGAGGAGATTGCCCGC
CTGAAGGCCCAGCTGGAGAAGAGGGGGATGCTGGGGAAGCGGCCCCGGAGGAAGAGCAGC
CGCAGGAAGAAGGCCGTGTCCGCCCCGCCTGGGTACCCTGAGGGCCCAGTGATTGAGGCC
TGGGTGGCAGAAGAGGAGGATGACAACAACAACAACCACCGCCCGCCCCAGCCCATCCTG
GAGTCAGCCTTGGAGAAGAACATGGAGAATTACCTGCAGGAACAGAAGGAGCGGCTGGAG
GAGGAGAAGGCAGCCATCCAGGATGACCGCAGCCTGGTGAGCGAGGAGAAGCAGAAGCTG
CTGGAGGAGAAGGAGAAGATGCTGGAGGACCTGCGGCGGGAACAGCAGGCCACAGAGCTG
CTTGCGGCCAAGTACAAG
gtaagggccccagaggagctgggcactcgagatgtccccgcaggggatcccggcaaggag
gctcttctttgagagtctgtgacctggcctgaagtggaggttctccctcagcaccgcaca
ctgccctcctgccaaatgtgcccccagagcagccaggcaaattgctgtgataccgggctg
EXON 2  102 bp
ctgggacctgagacactagaggggaaaactccattctccctgaaagccacaaggccccat
ctgggacacatctggtgtccactcccagaaggaccacagagcagggaagcaaaatctctc
cagctagcaatgttgtggaccctttgcaaagcccacctcccaacccctctgtgtccccag
GCCATGGAGAGCAAGCTCCTCATCGGGGGCAGGAACATCATGGATCACACCAACGAACAG
CAGAAGATGTTGGAACTGAAGAGGCAGGAGATTGCCGAGCAG
gtagggcctccaggtgccaggtccccttggagagtgtggcctgcagctcatgtctgggag
gtgcagggccgtaaaccatggtggactctggatctctggaattacagtgctgagaatctc
agacatgccaccctgggtcccacaggtctactagcccagggtcttccctttggcaggggc
EXON 3  123 bp
gggaactgagaggagggttcccaggggctctgcaggattgggtgggagcagtggatgtgg
gccatgggccatggtgaagccaggtcccgagacaggcagagtgagccagtcccctgagct
ttcctggccctcccgagtatgcactgctcctttgagccacactgcccgtccttggcctag
AAACGTCGTGAGCGGGAGATGCAGCAGGAGATGATGCTCCGGGACGAGGAGACTATGGAG
CTCCGGGGCACCTACACATCCCTGCAGCAGGAGGTGGAGGTCAAAACCAAGAAACTCAAG
AAG
gtgagacgctgcagcaggaccggttaaggtgtgctggaggcccagcagtctctgcccaag
ggatgtgtgcttcagggactcctccccatttggctggaactgctgaacccctgagtgaca
tggcttggcctcgggggtgagcaacagggggaggcaggaggcgggggctgggggtggagt
EXON 4  119 bp
taaatagcccagcccaattcgtggtgggttgggcacagcggggagttcagaaaaggaccc
gcagcctcatcctgggctgagtcggtagactctgagcctgcagccctgcggcccaggctg
ggtgactggggcctcgttgccacaccaagcagcctctgagtggcacctgtccccacccag
CTCTACGCCAAGCTGCAGGCGGTGAAGGCGGAGATCCAGGACCAGCATGATGAGTATATC
CGCGTGCGGCAGGACCTGGAGGAGGCGCAGAACGAGCAGACCCGCGAACTCAAGCTCAA
gtagggcccgcagctcttttcatcccgggtccccacagccagccatcattactcaggcct
ctcctcccctaaggcctcatcctgactgtctcctctcccatgagtcctttaggaataaaa
tgcgtctgagggctgagggatgggcccacgtgctggagtttcttctacctcctctgcctg
EXON 5  117 bp
tctcctgacctcgtgatccgcccgccttggtctcccaaagtgctgggattacaggcgtga
gccaccgtgcccagccccctctgcctcttggcttgttgcttctaatccttcaaccctcac
atgcaccacgtggtctctcgctcacccattttcccatcactccttcattcctgctcccag
GTACCTAATCATCGAGAACTTCATCCCGCCGGAGGAGAAGAACAAGATCATGAACCGGCT
TTTCCTGGACTGTGAGGAGGAGCAGTGGAAGTTCCAGCCACTGGTGCCAGCCGGCGT
gtgagtctctaacccagctgtctgggctgggggacttgtgggtccactccaggtcggggc
tggtgaggggcctgaggccttgcctgcagggagacagatgttttgtggattggggaaaag
atggggaggatgccgatgggggatgaatttctcaggatctaattgtaggggtctctatga
EXON 6  109 bp
atgagggggacaactgcactagcttcagttgtcaagctgtattagagcaaggagaagaaa
attccagaacttgcagtctgcagggcctcctagctacctgaatgatatttaggtcctcat
gatgtcatttgctgtttgtgttccacagaaatcctttctaatatagcctctttcctacag
CAGTAGCAGCCAGATGAAGAAGCGGCCAACATCTGCAGTGGGCTACAAGAGGCCTATCAG
CCAGTATGCTCGGGTTGCCATGGCAATGGGGTCCCACCCCAGGTACAGG
gtaagaagcggagaggggagaaagagcctacgggagggaggccgggcgaggtgtctcaca
cctgtaatcccagcactgtgggaggccgaggcaggtggatcacctgaggtcaggagttcg
agaccagcctggttaacatggtgaacccctgtctctactaaaaatacaaaaattagccag
EXON 7  173 bp
ggcaacagagtgagactccatctcagaagaaaaaaaaaaaagagcctatgggaggggatg
ctcacagcctctgcttcccctaaccacctcatcagccctgctacacccaagactggctga
gtccctagaaggcacagtgactgggcactgttcaagcctggcatgatattcccaccacag
GCTGAAAACATAATGTTTCTGGAGTTGGATGTGTCCCCTCCAGCTGTCTTTGAGATGGAA
TTCTCTCACGACCAAGAACAAGACCCTCGTGCGCTACACATGGAGAGGCTCATGCGATTG
GACAGCTTTCTGGAAAGACCTTCCACGTCTAAAGTCCGAAAGTCCAGATCCTG
gtcagtacctccatggtcccaggcagcactggacccaggaggcaggggaactgcaggcgc
tgggtgatgctaaagagggttttgctggtacccgaagggcaggaagggcaaggggtgact
ggggatgtcagaaggattcctgcagcaacaggatggggcaaaggagaggacccactttcc
EXON 8  2473 bp
caggcgctgggtgatgctaaagagggttttgctggtacccgaagggcaggaagggcaagg
ggtgactggggatgtcagaaggattcctgcagcaacaggatggggcaaaggagaggaccc
actttcctgtttcctgtatttccctaacctcccctttcgcctgcgtcatctcccctgcag
GTGCCAGAGTCCTCAGCGGCCTCCACCTTCCACCACACATGCCTCCCTGGCCTCTGCTTC
TCTGCGCCCTGCAACAGTGGCGGACCATGAGTGACAACCATCACGTCAGGCTGCCCATCC
AATAGACTCCTGGGATGGGGCAGCCAACCCTGGCTCATCTCATCTGCCGCTTGGTGCGTG
TGCGTGTGCGTGCATGTGCGTGTGCGTGTGTGCAGGGGTGAGAATCTGGCAGATGGTGCC
TCTGCCTGCTCTTCTTCGCCTCCTTTATTTAATTCATGTTATTTATTCGCGGAGCTCTGT
TCGTGTTGGGGAGATGCCCTCGCCTGAGCCGTCTGGGCCTACCGTGGTCACTGCGTAGCC
TCTTTTTCTTCTGACTTGAGAGCTCCCCCAGTCAGATCTCAGGCTTGTCCCCCTGTCAGC
TGCCTCCAGAAGGGAAGGTAGCCAGTGCCTGAGAAGACAGTCCCTTTTCTACCCACCGCA
CTCCATAACCTCCATCTTCTCCCACACTGATGGCGAGCAGCCCCTGAGCACTTTCTGGGA
CTGGGAGACTGCTTGGTGTTCCCTGAGGACAAGAGACATCCTGACAGTGTTGGGCATCTG
CTCCCCGTGGACACAGCCCCACTCTCCACTTTCTGAGCCTCAGACAACCTCATTCAGCCT
CTTGGGCTCCTTTTCAAGGACATTAATAACCTCACCAACATAGCTCATGCCCTTCAGCTT
TGACAAGAACTCACAGCTTCCCAAACTCTGCTTTCTGCCCACCTTGGATGGGAACTGTGG
ACCAAGCAATTACCATCGCCTTGGAACCTGCAGGAAATGGAACAGCAATTGAGACAACTT
GAACAGTCATCAACGGAAGTCCCTCCACTGGATTCCTTTGTTTCTGTCCCCTCCGAGGAG
TCATTTTGGTCGACAGGCTCTCAAGGCAACTCCCCATTTTCAAGAGGCTGCTCCTGCCTG
CTTCGATCATTTCTCCCTGCAGCTGCCTAGACCCCGTTCACAGTGGGAGGAGTCAATGTC
ATTCTACCCCTCGCTAAACGAAGATATTAACATCTATTGCTTTTTCCCTTCATCTGTCAC
AGGAAACAGAAGCCCAGGCACAATCTTTTCCAGCTTTGCCTGTTACCCCTGTTTCTGAAT
TGCATCTTTAAGGTATTATTTTGTTGAAAATAGATCCTTTATTCACTAGTTACGCAAATT
GGTTCCTAGGGGGATACTCCTTACCTTCCTTTGTGATGGCCCAAAATGTCTCTAGGTATC
TCAAGTGATAAGTAAATTTCTACAAAAAAAAATGGTTAATGTTCATTGACTGGCTTTTTA
AGTGTATATTTTGGAGGACGGGTGAAGAGGTCATAACGAAAGCAAGCGAGTGAATTAGGA
TTTCAAAGTGCCCTAATAGTGTGAGTCTCCAGTTCCTAGAATATGAAGAGTGCTGTCGTT
GGGGTGAAACCATGAGACTGACAGATCTGCCTGAAATGGGGGGTGTGGGAGGTGGTGGCG
GGGGTTATTCTCTTTCCTTCAGGAAATGAACCCTTCTTACATCATTCAAGTTCTGCTCTG
AGGATCAAGCTTGGGTCTGATTTAACTCAGCGACACTGTCATTTCTGCTTCATTACTGGA
CTAGAGGGTTGAGCCACCCACTTGCCATTTGCTCCTGTCCTTCCAGGAAATCACAATTTT
CATCAGAGCCCAAGAGATTATTTGAGACTCAGGATTCAGATCAGAGGTTCGACTGTGGCT
GGGACAGGAGTTGTGTGTAGAAATTCACCAGGTGGCCTGAGCGCAGGGGGACCTCCAGGG
CTGCGTTGAGCAGCCTCTCCCACTGACCTCTTTCTCGTTTGTGGACAAAGCAGCACGTAT
CACCTCATTCATCACTTGGACACATCGCCTTTGCATTGTCTTGTCACACCTCCCTCACAG
TCTTATAGCACAATATACCCAAATCAGCCCCCCCAGTCCGAGGGCTGGGCCCGAGGTATG
GTCGGAGGAGGAGCTCCTGCCTGCGGTTTTGTGTATGTGTGTATGTGTGTGCGTGTTTGT
GTGCGTGTTTACCTCCACAGGGGACACTCTACACTCAGTGTAAGATCTGCTGGGAACAGG
GCCACCAGGAGTGGCTGGATCTCAGTCTCTCTGTCTCTCTTTCTCTCCTTTTCCTTTTGG
TGTATCAAATATTTGATTGACAAAGTAAGGGCCTTGATTAGGACCAAATTCTCGTGTGTT
GCTATGGTCTTTATTTAGGACAACAATTAACAATGCAGTGGCCCATTCTTGTCACTCTAC
ACATATGACTATACGGGACATATGTAATATATAAATATATATATAAAACATTCCCCTCTG
TCCCCTTGGCTTCGGATGGAGGCCTTTCTGTTGAGCTGAAATGCACCTGCAGCTGGGTGC
TGCCAGCAGCTTGCAGGCCCCAGCCCTGTTCCAATCAATGCAGTTGACAATAAAGGAATG
AGTATCGTCACGG
agttgactgccttacttctcttccctttgtttcttcctactttaactccctccctttttc
attttctcctttctctctcttccatgtttttccagtaggggctcaagagtatatcagcca
gacgtggtggctcacacctgtaatcccagcactttgggaggcccaggcaggcagatcacc