Gene KCNS3 Variant 1
DNA : 54.28 KbNT_015926
mRNA : 2329 bp NM_002252
CDS : 1476 bp NP_002243
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  129 bp
cgcccgcgccctcggcccggggcgcccggctgcgggcccgaagcgaggggctggcggagc
tgcgaccaatggggcggcggccgagcggcgggccccgccccgtcccgtccggccccgccc
cgcccgcagctcccgggagcctcgctctagcggggcgggaccgacggacagaccggccga
CGCGGGCCACCCCGCTCTCCTCGCCGCCGCGGCGGCAGGCGCGGGGCCGCGCCGCGAGGC
CTGATCCCTGCAGCGCGGGCAGGCGGCGTCGCAGAGCGGAGCTAGCTGGATGCGTCCGGA
CTCCTGCAG
gtacctggctggcgtccccacctccctgcgcgctccggagacttctccgggcgaccctgc
aactttaccgcgccttcccccaccttttgctgccccagtctcctgtggtccaggtcgcgg
gtgcacgaccccgagggtctacggccgcagagcactttccgtccttctgggcgtctggcc
EXON 2  192 bp
gtccaatggcagtgatggttccacagggggaagagaccaccccccacttgctgagaatta
ggtggggctttcagatttgagtctcatcagcaaagtgcccagagtgttgatcctgaggta
gaatgtcttgggtgtatttcttccttgcagttacagcttggctgatggttttttctgcag
GTGAGAGTGATTTTCCAGTGATTGCTTTGGCCTGTACAACCAGAGAACAGGATTCTTCCC
TTCTTTTTGGCCACCAAATGCCTATGTGCACCACACATTCCAGTGTGCTGAGAAGGGCAG
AGCTTCTTGGATGATGATGGACGTCCCACCGGGCAGGATGAAGGCAGAGCGTGTGGCATC
TCCACCTCAAGG
gtaagagttgccattctatcttattttctcaagcacccattatttatcaaaggaggatga
gaatgagcgttacagtgtagtgagaaagatgaaagttagacacttctgatggtcaaatcc
actgggcagttgggacagatgactatgggaagaaaagtgttggtctcaaaggattagatt
EXON 3  2008 bp
gggaaaaatctgttttgtgttgattttcttctgaacaaaatgcataataatgtattcatt
tttattgcatttcctgctttgcttttaatgtagcccatcctcctggaaagggcagattaa
aaataagcttggctgggcacggcaggacagagtgctaatatcatcttgtgctctttccag
GTGCAGCCTGATCTTCCTCTTCTCCCTTGCCAGCCAGCACTCTGCCTTCTGTATCCACCA
TGGTGTTTGGTGAGTTTTTCCATCGCCCTGGACAAGACGAGGAACTTGTCAACCTGAATG
TGGGGGGCTTTAAGCAGTCTGTTGACCAAAGCACCCTCCTGCGGTTTCCTCACACCAGAC
TGGGGAAGCTGCTTACTTGCCATTCTGAAGAGGCCATTCTGGAGCTGTGTGATGATTACA
GTGTGGCCGATAAGGAGTACTACTTTGATCGGAATCCCTCCTTGTTCAGATATGTTTTGA
ATTTTTATTACACGGGGAAGCTGCATGTCATGGAGGAGCTGTGCGTATTCTCATTCTGCC
AGGAGATCGAGTACTGGGGCATCAACGAGCTCTTCATTGATTCTTGCTGCAGCAATCGCT
ACCAGGAACGCAAGGAGGAAAACCACGAGAAGGACTGGGACCAGAAAAGCCATGATGTGA
GTACCGACTCCTCGTTTGAAGAGTCGTCTCTGTTTGAGAAAGAGCTGGAGAAGTTTGACA
CACTGCGATTTGGTCAGCTCCGGAAGAAAATCTGGATTAGAATGGAGAATCCAGCGTACT
GCCTGTCCGCTAAGCTTATCGCTATCTCCTCCTTGAGCGTGGTGCTGGCCTCCATCGTGG
CCATGTGCGTTCACAGCATGTCGGAGTTCCAGAATGAGGATGGAGAAGTGGATGATCCGG
TGCTGGAAGGAGTGGAGATCGCGTGCATTGCCTGGTTCACCGGGGAGCTTGCCGTCCGGC
TGGCTGCCGCTCCTTGTCAAAAGAAATTCTGGAAAAACCCTCTGAACATCATTGACTTTG
TCTCTATTATTCCCTTCTATGCCACGTTGGCTGTAGACACCAAGGAGGAAGAGAGTGAGG
ATATTGAGAACATGGGCAAGGTGGTCCAGATCCTACGGCTTATGAGGATTTTCCGAATTC
TAAAGCTTGCCCGGCACTCGGTAGGACTTCGGTCTCTAGGTGCCACACTGAGACACAGCT
ACCATGAAGTTGGGCTTCTGCTTCTCTTCCTCTCTGTGGGCATTTCCATTTTCTCTGTGC
TTATCTACTCCGTGGAGAAAGATGACCACACATCCAGCCTCACCAGCATCCCCATCTGCT
GGTGGTGGGCCACCATCAGCATGACAACTGTGGGCTATGGAGACACCCACCCGGTCACCT
TGGCGGGAAAGCTCATCGCCAGCACATGCATCATCTGTGGCATCTTGGTGGTGGCCCTTC
CCATCACCATCATCTTCAACAAGTTTTCCAAGTACTACCAGAAGCAAAAGGACATTGATG
TGGACCAGTGCAGTGAGGATGCACCAGAGAAGTGTCATGAGCTACCTTACTTTAACATTA
GGGATATATATGCACAGCGGATGCACACCTTCATTACCAGTCTCTCTTCTGTAGGCATTG
TGGTGAGCGATCCTGACTCCACAGATGCTTCAAGCATTGAAGACAATGAGGACATTTGTA
ACACCACCTCCTTGGAGAATTGCACAGCAAAATGAGCGGGGGTGTTTGTGCCTGTTTCTC
TTATCCTTTCCCGACATTAGGTTAACACAGCTTTATAAACCTCAGTGGGTTCGTTAAAAT
CATTTAATTCTCAGGGTGTACCTTTCAGCCATAGTTGGACATTCATTGCTGAATTCTGAA
ATGATAGAATTGTCTTTATTTTTCTCTGTGAGGTCAATTAAATGCCTTGTTCTGAAATTT
ATTTTTTACAAGAGAGAGTTGTGATATAGTTTGGAATATAAGATAAATGGTATTGGGTGG
GGTTTGTGGCTACAGCTTATGCATCATTCTGTGTTTGTCATTTACTCACATTGAGCTAAC
TTTAAATTACTGACAAGTAGAATCAAAGGTGCAGCTGACTGAGACGACATGCATGTAAGA
TCCACAAAATGAGACAATGCATGTAAATCCATGCTCATGTTCTAAACATGGAAACTAGGA
GCCTAATAAACTTCCTAATTCAGTATGG
agaatgtcttggttgtatgtttttatgttgagtaactacattttagcatgttcaggattg
gtttggaagaaaaatgttctttttggagtaccaagagcccttcctttctttatgcttttg
aattttaggtatgtaccaagcatgtgctagctcttttttcagtagacttgatggtagttg