Gene KCNH7 Variant 2
DNA : 415.48 KbNT_005403
mRNA : 2432 bp NM_173162
CDS : 2199 bp NP_775185
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  288 bp
tgggaaattggcgctgtttgggagaagagaaacagatcgattgcccttgtgactccccgc
ccccttcccaccccacccccacagctccctccctctttccctcccccgccacctcccctc
accccgcctccttcccgttccccacccccaaaccctctcacccgcggcagtccggtgcga
GGCCCCCTCCGGAAGGTGAGGGGAATGGATTGGACTCCGGTGGGGAAAGCGGGTGTCTAG
AAGTGGTGCTAATGGGAAGAGAATTCTGGTTTCAAAAGAGGATGCTCTGCCACAAAGAGC
GGCTCGCGCGCTGGCCTGGGCTCTAGCCGAGGAGAGATCCCGGGAGAACTCCAGAGCTCC
GGGGGAGCGCTCCTCGGAAGACCGGGGCCAACATGCCTGTGCGCAGGGGGCATGTGGCAC
CACAAAATACATTTCTGGGGACCATCATTCGGAAATTTGAAGGGCAAA
gtaagttcgtttgttctcttctctcgccctcgctttctgccttgttagtgcacttggcgt
ccaccgcttccaaggtggggagaccggcaactccaggctctgtcaacttaagaggctgtg
aaaccgagccaggaggttcgaatggcagcgggagtgttcttctgatattaattttgattt
EXON 2  231 bp
atctcacatttaaagtttgtggggtttcttgtgttttcttttttcataagggctggagag
attagtaatttggggaggcacctgcatttcagagctcttattatgcaacaaattgcttca
gtgttacggagaatattgtggaagctttttcaaagatgccatactgtcttcttattacag
ATAAAAAATTTATCATTGCAAATGCCAGAGTGCAGAACTGTGCCATCATTTATTGCAACG
ATGGGTTCTGTGAGATGACTGGTTTCTCCAGGCCAGATGTCATGCAAAAGCCATGCACCT
GCGACTTTCTCCATGGACCCGAGACCAAGAGGCATGATATTGCCCAAATTGCCCAGGCAT
TGCTGGGGTCAGAAGAGAGGAAAGTGGAGGTCACCTACTATCACAAAAATG
gtaaaattcctctatttaggattccttctatttgatcccattgaaaagaaattttgacta
ttaaaagttcatatgcaaagaagcccaaaatgttcaattgtagatatatgctttgcatat
agtattttgggatccaacatatatgggtattctgattagtggtctggtagaaacaatttt
EXON 3  156 bp
tgtattttaaatgaatatggtatgcaataaaatatgaagtaaaaaagatcaaattatttt
ttaatatcagtgatcatttaagatacaaatttccttaagagtatatttcaattttaatgt
tacttgatagttcagaatgaaggcatatttttaactaacattcatttttaatctccttag
GGTCCACTTTTATTTGTAACACTCACATAATTCCAGTGAAAAACCAAGAGGGCGTGGCTA
TGATGTTCATCATTAATTTTGAATATGTGACGGATAATGAAAACGCTGCCACCCCAGAGA
GGGTAAACCCAATATTACCAATCAAAACTGTAAACC
gtaagtaaaaggcaatgtgtactcaatgctcttgataattctgctactgtagtcacttta
atacagtcttcatttcaattcagttctcaaaatatctttatatttgaagtaaaataattt
gacatgagtaagccattagctcatgttaccttttggtaccttccaaaatttgttggctgc
EXON 4  429 bp
tttatatcatacttcacattggtctcagagaagttttctacaatatcctctattccaact
ataaccattgattcaaaattatttttacatggtgtttaaatatgagtcaacaatgtttgt
ttttgttacaggatatatcatttgccttataataatgctctctcctgtctccatttatag
GGAAATTTTTTGGGTTCAAATTCCCTGGTCTGAGAGTTCTCACTTACAGAAAGCAGTCCT
TACCACAAGAAGACCCCGATGTGGTGGTCATCGATTCATCTAAACACAGTGATGATTCAG
TAGCCATGAAGCATTTTAAGTCTCCTACAAAAGAAAGCTGCAGCCCCTCTGAAGCAGATG
ACACAAAAGCTTTGATACAGCCCAGCAAATGTTCTCCCTTGGTGAATATATCCGGACCTC
TTGACCATTCCTCTCCCAAAAGGCAATGGGACCGACTCTACCCTGACATGCTGCAGTCAA
GTTCCCAGCTGTCCCATTCCAGATCAAGGGAAAGCTTATGTAGTATACGGAGAGCATCTT
CGGTCCATGATATAGAAGGATTCGGCGTCCACCCCAAGAACATATTTAGAGACCGACATG
CCAGCGAAG
gtatgtttgatttttttttaaatggaaacatatattaatgggtaataaatgattatttgc
atattgtttgaaatttcaacaataatctctgtgcattggggaaagaaatgtgattaaagg
ctattaaaaacctgagtcctacactcagagttgttactgatttcctctttgaacccttgt
EXON 5  215 bp
catgccattccatgtggcccaaggtgaccctaagccctgtgtccaggtataagctggctg
cattcagtcacactcaaatcaggatcatattggtcaggaatcattagcagggcattcaga
actgtctctttcttctatatcttcttatattactcttacaaatactttccatttttttag
GGCCTTTTAATCATATCAAGTCAAGCCTCCTGGGATCCACATCAGATTCAAACCTCAACA
AATACAGCACCATTAACAAGATTCCACAGCTCACTCTGAATTTTTCAGAGGTCAAAACTG
AGAAAAAGAATTCATCACCTCCTTCTTCAGATAAAACCATTATTGCACCCAAGGTTAAAG
ATCGAACACACAATGTGACTGAGAAAGTGACCCAG
gtaggacacaattttcttatcaatttcaactgttttagaggtttgtttctgcaccatgaa
acatattctttttcttataaatgactgtcggtagaggtaagacattttttctttgtactc
ctatttatcttgagatgttgggtaactctctaatataacagattaataaagctgtatact
EXON 6  426 bp
acactgtataagtttatatgggtttatgtaatgtatgtgtgtgtttcataaatacttcca
aattacatgaattctctctaataaattttactgtataattagttcccttaatatttgata
ggtttaccagattaaaaatggcatatttatgtagtgtatgattttcttttgcacattcag
GTTCTCTCTTTAGGAGCAGATGTCCTACCTGAATACAAACTGCAGACACCACGCATCAAC
AAGTTTACGATATTGCACTACAGCCCTTTCAAGGCAGTCTGGGACTGGCTTATCCTGCTG
TTGGTCATATACACTGCTATATTTACTCCCTACTCTGCAGCCTTCCTCCTCAATGACAGA
GAAGAACAGAAAAGACGAGAATGTGGCTATTCTTGTAGCCCTTTGAATGTGGTAGACTTG
ATTGTGGATATTATGTTTATCATAGATATTTTAATAAACTTCAGAACAACATATGTAAAT
CAGAATGAAGAAGTGGTAAGTGATCCCGCCAAAATAGCAATACACTACTTCAAAGGCTGG
TTCCTGATTGACATGGTTGCAGCAATTCCTTTTGACTTGCTGATTTTTGGATCAGGTTCT
GATGAG
gtaagaactgcttaagattcttattttctgaaagattgcaattataaaagtgaatctatt
ttaactgcaaaaagaagagttgctttgcaagcttcttgtatctcactgataaaattcatt
ttcaattggggatactacagaatgaaatgaaaccattttgccattgcaaatcaaattctt
EXON 7  400 bp
tattttccaaagcaggtatcacataaaaaaaaaagaaccaagtttaatactgaatttaaa
taggcagttatccttaatgctaccctattgtcttaacctgtttttgtccactttgcttca
tatgaatgtactttgaattgtttgccgaccgtttctgactgtgtacatttatttctacag
ACAACAACATTAATTGGTCTTTTGAAGACTGCCCGACTCCTCCGTCTTGTGCGCGTGGCC
AGGAAACTGGATCGATATTCAGAATATGGCGCTGCTGTTCTAATGCTCTTAATGTGCATC
TTTGCCCTGATTGCTCACTGGCTGGCTTGCATTTGGTATGCGATTGGGAATGTAGAAAGG
CCTTACCTGACTGACAAAATCGGATGGTTGGATTCCTTAGGACAGCAAATTGGGAAACGT
TACAATGACAGTGACTCAAGTTCTGGACCATCCATTAAAGACAAATACGTCACAGCACTT
TATTTTACCTTCAGCAGTTTAACCAGTGTAGGATTCGGGAATGTGTCTCCTAACACGAAT
TCGGAGAAAATCTTTTCAATTTGTGTCATGTTGATTGGCT
gtaagtagctttctcttctgttgtctattaggatagaataataccttgaaattaatattt
ctacaatatttagagtaaggcaaagaaaaagattacagaaaattgaggagataatgggat
tacatatatgggtactgtattccatcaaatctgattctctctgtgaagtagagacaccaa
EXON 8  287 bp
ctttatcactaaaattatgaaatgtaaagcagttttagtttaacttctttttttccccgt
gatccaatggtaaatccccactagattgagataatcaaaatccacatgcttgatactcta
acaatatataacacacctatgtgcagtttccccgataactttgttttttatccaatccag
CACTAATGTATGCAAGCATTTTTGGGAATGTATCTGCAATTATCCAAAGACTATACTCGG
GAACTGCCAGGTACCACATGCAGATGCTGCGAGTAAAAGAGTTCATTCGCTTTCACCAAA
TCCCCAACCCTCTGAGGCAACGTCTTGAAGAATATTTCCAGCACGCATGGACTTACACCA
ATGGCATTGACATGAACATGGTATGTATGTCTGTTTTCCAAAATGAAAGTGCCGCAGGCA
TTATAGTGATAGCCAAAATGGAATAAAAGCCGGAATCACCAGCTTTG
aaccccttgcttttgttttcttctctcggatgtgtattttctcccctggagatagtctct
cattctcaattcatggcattgcatggtgctatatctagttatactgtgtggcaaaggcat
tataacatgatgcaaactgatataactgtgtgtagtagagttcccacttctggtgagaga