Gene KCNH7 Variant 1
DNA : 467.32 KbNT_005403
mRNA : 4225 bp NM_033272
CDS : 3591 bp NP_150375
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  288 bp
tgggaaattggcgctgtttgggagaagagaaacagatcgattgcccttgtgactccccgc
ccccttcccaccccacccccacagctccctccctctttccctcccccgccacctcccctc
accccgcctccttcccgttccccacccccaaaccctctcacccgcggcagtccggtgcga
GGCCCCCTCCGGAAGGTGAGGGGAATGGATTGGACTCCGGTGGGGAAAGCGGGTGTCTAG
AAGTGGTGCTAATGGGAAGAGAATTCTGGTTTCAAAAGAGGATGCTCTGCCACAAAGAGC
GGCTCGCGCGCTGGCCTGGGCTCTAGCCGAGGAGAGATCCCGGGAGAACTCCAGAGCTCC
GGGGGAGCGCTCCTCGGAAGACCGGGGCCAACATGCCTGTGCGCAGGGGGCATGTGGCAC
CACAAAATACATTTCTGGGGACCATCATTCGGAAATTTGAAGGGCAAA
gtaagttcgtttgttctcttctctcgccctcgctttctgccttgttagtgcacttggcgt
ccaccgcttccaaggtggggagaccggcaactccaggctctgtcaacttaagaggctgtg
aaaccgagccaggaggttcgaatggcagcgggagtgttcttctgatattaattttgattt
EXON 2  231 bp
atctcacatttaaagtttgtggggtttcttgtgttttcttttttcataagggctggagag
attagtaatttggggaggcacctgcatttcagagctcttattatgcaacaaattgcttca
gtgttacggagaatattgtggaagctttttcaaagatgccatactgtcttcttattacag
ATAAAAAATTTATCATTGCAAATGCCAGAGTGCAGAACTGTGCCATCATTTATTGCAACG
ATGGGTTCTGTGAGATGACTGGTTTCTCCAGGCCAGATGTCATGCAAAAGCCATGCACCT
GCGACTTTCTCCATGGACCCGAGACCAAGAGGCATGATATTGCCCAAATTGCCCAGGCAT
TGCTGGGGTCAGAAGAGAGGAAAGTGGAGGTCACCTACTATCACAAAAATG
gtaaaattcctctatttaggattccttctatttgatcccattgaaaagaaattttgacta
ttaaaagttcatatgcaaagaagcccaaaatgttcaattgtagatatatgctttgcatat
agtattttgggatccaacatatatgggtattctgattagtggtctggtagaaacaatttt
EXON 3  156 bp
tgtattttaaatgaatatggtatgcaataaaatatgaagtaaaaaagatcaaattatttt
ttaatatcagtgatcatttaagatacaaatttccttaagagtatatttcaattttaatgt
tacttgatagttcagaatgaaggcatatttttaactaacattcatttttaatctccttag
GGTCCACTTTTATTTGTAACACTCACATAATTCCAGTGAAAAACCAAGAGGGCGTGGCTA
TGATGTTCATCATTAATTTTGAATATGTGACGGATAATGAAAACGCTGCCACCCCAGAGA
GGGTAAACCCAATATTACCAATCAAAACTGTAAACC
gtaagtaaaaggcaatgtgtactcaatgctcttgataattctgctactgtagtcacttta
atacagtcttcatttcaattcagttctcaaaatatctttatatttgaagtaaaataattt
gacatgagtaagccattagctcatgttaccttttggtaccttccaaaatttgttggctgc
EXON 4  429 bp
tttatatcatacttcacattggtctcagagaagttttctacaatatcctctattccaact
ataaccattgattcaaaattatttttacatggtgtttaaatatgagtcaacaatgtttgt
ttttgttacaggatatatcatttgccttataataatgctctctcctgtctccatttatag
GGAAATTTTTTGGGTTCAAATTCCCTGGTCTGAGAGTTCTCACTTACAGAAAGCAGTCCT
TACCACAAGAAGACCCCGATGTGGTGGTCATCGATTCATCTAAACACAGTGATGATTCAG
TAGCCATGAAGCATTTTAAGTCTCCTACAAAAGAAAGCTGCAGCCCCTCTGAAGCAGATG
ACACAAAAGCTTTGATACAGCCCAGCAAATGTTCTCCCTTGGTGAATATATCCGGACCTC
TTGACCATTCCTCTCCCAAAAGGCAATGGGACCGACTCTACCCTGACATGCTGCAGTCAA
GTTCCCAGCTGTCCCATTCCAGATCAAGGGAAAGCTTATGTAGTATACGGAGAGCATCTT
CGGTCCATGATATAGAAGGATTCGGCGTCCACCCCAAGAACATATTTAGAGACCGACATG
CCAGCGAAG
gtatgtttgatttttttttaaatggaaacatatattaatgggtaataaatgattatttgc
atattgtttgaaatttcaacaataatctctgtgcattggggaaagaaatgtgattaaagg
ctattaaaaacctgagtcctacactcagagttgttactgatttcctctttgaacccttgt
EXON 5  21 bp
tttttagtatatgcatgttacttggtggaatagtacaaaatgttaatttcaattaaagag
aaattttccatcatattctgatttctctgattgtttttatacaggtaattcagtgtatat
aatataattttagtcttctttttatatttctctttttttatccttatgtgctcaaaacag
ACAATGGTCGCAATGTCAAAG
gtaatgtacaaactcaaatttcaccatctgatgttcaacctgcccctttactcggcatgt
taacttgcctgctgtatgccctgttcagtgcaacatcttcatgctgcccttagctatttg
gggtgcctggtggagacatcatggcttgattttgctacagacattgttatttctctgctg
EXON 6  215 bp
catgccattccatgtggcccaaggtgaccctaagccctgtgtccaggtataagctggctg
cattcagtcacactcaaatcaggatcatattggtcaggaatcattagcagggcattcaga
actgtctctttcttctatatcttcttatattactcttacaaatactttccatttttttag
GGCCTTTTAATCATATCAAGTCAAGCCTCCTGGGATCCACATCAGATTCAAACCTCAACA
AATACAGCACCATTAACAAGATTCCACAGCTCACTCTGAATTTTTCAGAGGTCAAAACTG
AGAAAAAGAATTCATCACCTCCTTCTTCAGATAAAACCATTATTGCACCCAAGGTTAAAG
ATCGAACACACAATGTGACTGAGAAAGTGACCCAG
gtaggacacaattttcttatcaatttcaactgttttagaggtttgtttctgcaccatgaa
acatattctttttcttataaatgactgtcggtagaggtaagacattttttctttgtactc
ctatttatcttgagatgttgggtaactctctaatataacagattaataaagctgtatact
EXON 7  426 bp
acactgtataagtttatatgggtttatgtaatgtatgtgtgtgtttcataaatacttcca
aattacatgaattctctctaataaattttactgtataattagttcccttaatatttgata
ggtttaccagattaaaaatggcatatttatgtagtgtatgattttcttttgcacattcag
GTTCTCTCTTTAGGAGCAGATGTCCTACCTGAATACAAACTGCAGACACCACGCATCAAC
AAGTTTACGATATTGCACTACAGCCCTTTCAAGGCAGTCTGGGACTGGCTTATCCTGCTG
TTGGTCATATACACTGCTATATTTACTCCCTACTCTGCAGCCTTCCTCCTCAATGACAGA
GAAGAACAGAAAAGACGAGAATGTGGCTATTCTTGTAGCCCTTTGAATGTGGTAGACTTG
ATTGTGGATATTATGTTTATCATAGATATTTTAATAAACTTCAGAACAACATATGTAAAT
CAGAATGAAGAAGTGGTAAGTGATCCCGCCAAAATAGCAATACACTACTTCAAAGGCTGG
TTCCTGATTGACATGGTTGCAGCAATTCCTTTTGACTTGCTGATTTTTGGATCAGGTTCT
GATGAG
gtaagaactgcttaagattcttattttctgaaagattgcaattataaaagtgaatctatt
ttaactgcaaaaagaagagttgctttgcaagcttcttgtatctcactgataaaattcatt
ttcaattggggatactacagaatgaaatgaaaccattttgccattgcaaatcaaattctt
EXON 8  400 bp
tattttccaaagcaggtatcacataaaaaaaaaagaaccaagtttaatactgaatttaaa
taggcagttatccttaatgctaccctattgtcttaacctgtttttgtccactttgcttca
tatgaatgtactttgaattgtttgccgaccgtttctgactgtgtacatttatttctacag
ACAACAACATTAATTGGTCTTTTGAAGACTGCCCGACTCCTCCGTCTTGTGCGCGTGGCC
AGGAAACTGGATCGATATTCAGAATATGGCGCTGCTGTTCTAATGCTCTTAATGTGCATC
TTTGCCCTGATTGCTCACTGGCTGGCTTGCATTTGGTATGCGATTGGGAATGTAGAAAGG
CCTTACCTGACTGACAAAATCGGATGGTTGGATTCCTTAGGACAGCAAATTGGGAAACGT
TACAATGACAGTGACTCAAGTTCTGGACCATCCATTAAAGACAAATACGTCACAGCACTT
TATTTTACCTTCAGCAGTTTAACCAGTGTAGGATTCGGGAATGTGTCTCCTAACACGAAT
TCGGAGAAAATCTTTTCAATTTGTGTCATGTTGATTGGCT
gtaagtagctttctcttctgttgtctattaggatagaataataccttgaaattaatattt
ctacaatatttagagtaaggcaaagaaaaagattacagaaaattgaggagataatgggat
tacatatatgggtactgtattccatcaaatctgattctctctgtgaagtagagacaccaa
EXON 9  200 bp
ctttatcactaaaattatgaaatgtaaagcagttttagtttaacttctttttttccccgt
gatccaatggtaaatccccactagattgagataatcaaaatccacatgcttgatactcta
acaatatataacacacctatgtgcagtttccccgataactttgttttttatccaatccag
CACTAATGTATGCAAGCATTTTTGGGAATGTATCTGCAATTATCCAAAGACTATACTCGG
GAACTGCCAGGTACCACATGCAGATGCTGCGAGTAAAAGAGTTCATTCGCTTTCACCAAA
TCCCCAACCCTCTGAGGCAACGTCTTGAAGAATATTTCCAGCACGCATGGACTTACACCA
ATGGCATTGACATGAACATG
gtatgtatgtctgttttccaaaatgaaagtgccgcaggcattatagtgatagccaaaatg
gaataaaagccggaatcaccagctttgaaccccttgcttttgttttcttctctcggatgt
gtattttctcccctggagatagtctctcattctcaattcatggcattgcatggtgctata
EXON 10  253 bp
taaaaattttgacatgtttagcaaatcaagtattcattaaggtaggcgaggtagaagagt
agtaggaactcctgcgtggcaatgactacacctgcagttctgtgagcaagaaattgactg
tatttcaggcagagatacccagaacactggtagtatgaaactctttctttttttcctcag
GTCCTAAAGGGTTTCCCAGAATGCTTACAAGCAGACATTTGTCTACATCTCAACCAGACA
TTGCTGCAAAACTGCAAAGCCTTTCGGGGGGCAAGTAAAGGTTGCCTTAGAGCTTTGGCA
ATGAAGTTCAAAACCACCCATGCACCTCCAGGAGACACCCTCGTTCACTGTGGGGATGTC
CTCACTGCACTTTATTTCTTATCCAGAGGCTCCATTGAAATTCTCAAAGATGACATTGTG
GTGGCTATTCTGG
gtgagtgttttagaagtgcatggtgacagattcagttattagcttgtaatgcatagttta
aaatgattaggaaaaaaagactgatgtatgtattcataagaacagtttaagatggtgggt
aatttgaaagctgcatttaaaattcagttcaaaccaaattaacctttcagaaaatatgtt
EXON 11  206 bp
ttagagacaaatttccactcaccaaacatggtatgggcatttagttaaggtgctggaaca
ttgctcaccaagtctggttcagggattgatcaattgtttaatgacccccttctactttta
gaaggagaacattgagtttggattccctttccccgcctctttttctttatattttcttag
GAAAAAATGATATATTTGGAGAAATGGTTCATCTTTATGCCAAACCTGGAAAGTCTAATG
CAGATGTAAGAGCCCTCACATACTGTGACTTGCATAAGATTCAGCGAGAAGACTTGTTAG
AGGTTTTGGATATGTATCCTGAGTTTTCTGATCACTTTCTAACAAACCTAGAGTTGACTT
TCAACCTAAGGCATGAGAGCGCAAAG
gtatatgttaactgtttgcttatgtctgtatttctgacattttattttattcttgaattg
cacaaatacttctgaaaaatcaagcaaaatattgcagcaagactttaccaattctgaata
tttggaaggaaaggccaactgaatattaaaatttctgaattataggaaagaaatttagcc
EXON 12  97 bp
ctgtgtatgttacaataaagagacaagtattaagcaaggtattttagctgtttgcctgca
atctaataattaagtctcaagatggttgaaacaatatgaaatagtaaacagtttactgaa
tagtacattgtgttctaattcagtaatctttcattttatcttcatgttccattaacaaag
GCTGATCTCCTACGATCACAATCCATGAATGATTCAGAAGGAGACAACTGTAAACTAAGA
AGAAGGAAATTGTCATTTGAAAGTGAAGGAGAGAAAG
gtaattcattccattcctaaagtttaaatgtagagcatgtggtaattagccttcttactt
aaatgttcattttacttctgacttcaagagtatattttactcaggctttaggagggcaga
tcctttgctttattcagtagctaatgatctggtttccagtttctgattgatagctctcaa
EXON 13  252 bp
aatttactttactaagataatctaataacccttgaatttaaaaaattgagtacccaagta
gctacattttcaataggaaaaagctagtttatatatatagctaggtagtgtaatatgcat
accgtctcacatttaattgtctgctataaaataacttttctttgatatattttggcaaag
AAAACAGTACAAATGATCCTGAAGACTCTGCAGATACCATAAGACATTATCAGAGTTCCA
AGAGACACTTTGAAGAGAAAAAAAGCAGATCCTCATCTTTCATCTCCTCCATTGATGATG
AACAAAAGCCGCTCTTCTCAGGAATAGTAGACTCTTCTCCAGGAATAGGGAAAGCATCTG
GGCTCGATTTTGAAGAAACAGTGCCCACCTCAGGAAGAATGCACATAGATAAAAGAAGTC
ACTCTTGCAAAG
gtaatccagagttagacatcaggtggtctctcttcagtgctaatcacaaaatggtgactt
tttacaaattaagaactgtactgacacatgttaatctaattgttctcaacttcatgaaat
gttcgcgaagcgttcagatttcagatcatccatgaagtgtttgcactattctaaaacaag
EXON 14  169 bp
gtgaaagtgggactctgctaccaactggccgtggcccctggacacatcactgaatacttt
tggttctctgtctctcaggttatactccgatcctttccagcttgtcttgtggatatctat
gaattattgacgcaaaggggcacctaagagtgttgacatccatcttgctattttccacag
ATATCACTGACATGCGAAGCTGGGAACGAGAAAATGCACATCCCCAGCCTGAAGACTCCA
GTCCATCTGCACTTCAGCGAGCTGCCTGGGGTATCTCTGAAACCGAAAGCGACCTCACCT
ACGGGGAAGTGGAACAAAGATTAGATCTGCTCCAGGAGCAACTTAACAG
gtataagcagtgatgggcaaaaggagaacataacccaaccccttacatgggtccagtttt
actccttacaaatggaaaattctccttgccatgatctcataatttccttatacatttact
tatttaaaataagactagaagttgacagaataatttgtgttgaaaggagcatttatttag
EXON 15  193 bp
attagtgagacatacacagtaagtatccgtcaggaaagaatctctgtgctccctctcctg
tccttcttgtttaaagcaaggccataattctgtttcttggtagtgctgaaatttttttaa
atgctcctgaaattctggactattttagactgtcttttcctacttctgtctgttctgtag
GCTTGAATCCCAAATGACCACTGACATCCAGACCATCTTACAGTTGCTGCAGAAACAAAC
CACTGTGGTCCCCCCAGCCTACAGTATGGTAACAGCAGGATCAGAATATCAGAGACCCAT
CATCCAGCTGATGAGAACCAGTCAACCGGAAGCATCCATCAAAACTGACCGAAGTTTCAG
CCCTTCCTCACAA
gtaagtgtggataccatccaaccaagagtgtctctcacagtgtgtttccaggggtcacct
aatcagaatcacttggggtgctgtggaaaaggcagatttctgtccctatctctgtttcta
ctcaaatagaatttctggaaatgggccctgtaatctgcattttaaacaagcccacgctga
EXON 16  689 bp
tctgtactgataaccaatctccgacgtcctgactcattttaggagggaaatgttggctaa
tatcactaatcaaatatagattaatgaggaaagaaaatgcttaagtttttattagtgtaa
ttttcaatgactatctatcaatgtgaattataaaaacttgttttgttctttttccatcag
TGTCCTGAATTTCTAGACCTTGAAAAATCTAAACTTAAATCCAAAGAATCCCTTTCAAGT
GGGGTGCATCTGAACACAGCTTCAGAAGACAACTTGACTTCACTTTTAAAACAAGACAGT
GATCTCTCTTTAGAGCTTCACCTGCGGCAAAGAAAAACTTACGTTCATCCAATTAGGCAT
CCTTCTTTGCCAGATTCATCCCTAAGCACTGTAGGAATCGTGGGTCTTCATAGGCATGTT
TCTGATCCTGGTCTTCCAGGGAAATAATCATTTTGTACTATTTACTCCACATACAATGTA
AGTGCTTTTAATGGCTGTTTTCCTTTTTCTATTTAAATCCTCTCTACTTGACTCAGGGGC
TCACAAGGTACCATTATATGCAAAAGTACTGTATATTTTCCTAAATTGAAGCTTGTAAGG
TAAAACTGAGCAGTTAGGATGTAAATATACATAAGAACTTTTGGTTCCAAATGTTAAAAC
TGCCAGCATCTCACGGCACCTTATTTTTTATTTTTATTTTTTAAATCACATGCATGTTAG
GAAACTCCAATTTCTCTTGCATGGAGACTCCTATTTACTGCTTTTACTAAACCAGTACTT
CGTTATGAAAATGCCTTCCACGCAAATAAGAAACCAAGGGATAAAACTGTTCATGGATGC
AACTCAAATTCAGATGATCCTCAACTCAT
gggaattccagggggataaagggaacttagtcacttttgcacacagattcaggtctttct
gtatcaagatgttcaaagttaattacgttcattcctccacactggaagaaaaaatacaaa
gtttgagttgtaaacctctgacagtataggaagccatatccaaaaactaaacataggcca