Gene KCNE4 Variant 1
DNA : 1.70 KbNT_005403
mRNA : 1169 bp NM_080671
CDS : 513 bp NP_542402
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  66 bp
tttttcacttttcacagctgcaaagttcagggagttgaactgcagtgctttcagttcact
gctcactctgccacgatcaatctctgttgtaaattttcctcccagagcacgtgacgatgc
acttcttgactatatatcccaactgcagcagcggagttgtcagagcgcagagccggacag
AGCAGAAGAACCCTCTTGGACTGGACGATTTGGGAATTCAAAACTTGGGACAAACTGTCA
GCCTTG
gtaagtcagcaaggctacactttgctttcagaaacatttgaaagagggacatttttgcca
attaatagatgaatttttttcctttattttcttcctgcttttctttgttctaaggaaaca
ttgttttgaatttaaaatagtttggttttggaaacacaatgtaaactttgtttctgctca
EXON 2  1103 bp
tcccgtgcactccaagccctcatagctcactcttgtcagctgtttggcgaaccctcttat
gctatttctttcatgcacttttaagcttttttggtattgcagttccacaaacctcgtgct
cccccacctccctgtgcccaggacctgggggagagttctaacctgcggctttttccccag
CCCCTGCTGTGGAGGCAGCCTCAATGCTGAAAATGGAGCCTCTGAACAGCACGCACCCCG
GCACCGCCGCCTCCAGCAGCCCCCTGGAGTCCCGTGCGGCCGGCGGCGGCAGCGGCAATG
GCAACGAGTACTTCTACATTCTGGTTGTCATGTCCTTCTACGGCATTTTCTTGATCGGAA
TCATGCTGGGCTACATGAAATCCAAGAGGCGGGAGAAGAAGTCCAGCCTCCTGCTGCTGT
ACAAAGACGAGGAGCGGCTCTGGGGGGAGGCCATGAAGCCGCTGCCTGTGGTGTCGGGCC
TGAGGTCGGTGCAGGTGCCCCTGATGCTGAACATGCTGCAGGAGAGCGTGGCGCCCGCGC
TGTCCTGCACCCTCTGTTCCATGGAAGGGGACAGCGTGAGCTCCGAGTCCTCCTCCCCGG
ACGTGCACCTCACCATTCAGGAGGAGGGGGCAGACGATGAGCTGGAGGAGACCTCGGAGA
CGCCCCTCAACGAGAGCAGCGAAGGGTCCTCGGAGAACATCCATCAGAATTCCTAGCACC
CCCGGGACCCCTGCCGGTGGCTCCATCAGCCAGCAACCTTAGAGAGAGGAAAGACAGTTT
TCAAGTGTCTGGTTTCACTTTCACAGTGCGGCTGCCACTTTGAAGAGACCCTTGGTAAAC
CCCTGATTCGGGGTGGGGTGGGGGACTAGGCTCAGCCGGAACCAGCACCTCCAAGGAGTC
CGGGAGGTGCCTGTGGTTTGCACCCACCACTGAAAAAGCCGCGGAGATGCGCAGCGCGTA
CACTGACTTTGGGGCCTGGGTGTTGGGGTTCTGATCAGAATTTGGCGGGATGATATGTTT
GCCATTTTCTCACTGGATGCCCTGGGTAGCTCCTGCAGGGTCTGCCTGTTCCCAGGGCTG
CCGAATGCTTAGGACACGCTGAGAGACTAGTTGTGATTTGCTATTTTGCCTAGAGCTTTG
TCCTTCTAGATCTGATTGGCTGTAAGTATCTCTACTGTGTACCTGTGGCATTCCTTCACA
GTGGGTTACAAGCTTCTTTTGGATTAGAGGGGGATTTTTGATGGGAGAAAGCTGGAGATC
TGAACCCAGCCCATTTGCACACT
ataagaaaaaaaagtaacttttaaacctgttaacattggccggggttataagagatgatc
ttctattttgaccttttgtctaacttatgaccttgaactctgacctgtgaccatgcagca
tcacatgatggcatgacgttctttggatcagaagagcttccccagaatctaacctgcact