Gene IRS1 Variant 1
DNA : 64.54 KbNT_005403
mRNA : 5800 bp NM_005544
CDS : 3729 bp NP_005535
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  4771 bp
tcctagcgctgcgccggggtcggcgcgggcgccgctgcagcacggctggggggcggagag
gggcgggcgcggggcgggctcggcccggaatgtagagacccgggcgggagcctcccggcg
gcggctgcccggctgccgagcgcggaggctccgtcacgtgtttttctcctccgagtgaga
CGGCGGCGCGGTCGGAGGGGGCCGGCGCGCAGAGCCAGACGCCGCCGCTTGTTTTGGTTG
GGGCTCTCGGCAACTCTCCGAGGAGGAGGAGGAGGAGGGAGGAGGGGAGAAGTAACTGCA
GCGGCAGCGCCTCCCGAGGAACAGGCGTCTTCCCCGAACCCTTCCCAAACCTCCCCCATC
CCCTCTCGCCCTTGTCCCCTCCCCTCCTCCCCAGCCGCCTGGAGCGAGGGGCAGGGATGA
GTCTGTCCCTCCGGCCGGTCCCCAGCTGCAGTGGCTGCCCGGTATCGTTTCGCATGGAAA
AGCCACTTTCTCCACCCGCCGAGATGGGCCCGGATGGGGGCTGCAGAGGACGCGCCCGCG
GGCGGCGGCAGCAGCAGCAGCAGCAGCAGCAGCAACAGCAACAGCCGCAGCGCCGCGGTC
TCTGCGACTGAGCTGGTATTTGGGCGGCTGGTGGCGGCTGGGACGGTTGGGGGGTGGGAG
GAGGCGAAGGAGGAGGGAGAACCCCGTGCAACGTTGGGACTTGGCAACCCGCCTCCCCCT
GCCCAAGGATATTTAATTTGCCTCGGGAATCGCTGCTTCCAGAGGGGAACTCAGGAGGGA
AGGCGCGCGCGCGCGCGCGCTCCTGGAGGGGCACCGCAGGGACCCCCGACTGTCGCCTCC
CTGTGCCGGACTCCAGCCGGGGCGACGAGAGATGCATCTTCGCTCCTTCCTGGTGGCGGC
GGCGGCTGAGAGGAGACTTGGCTCTCGGAGGATCGGGGCTGCCCTCACCCCGGACGCACT
GCCTCCCCGCCGGGCGTGAAGCGCCCGAAAACTCCGGTCGGGCTCTCTCCTGGGCTCAGC
AGCTGCGTCCTCCTTCAGCTGCCCCTCCCCGGCGCGGGGGGCGGCGTGGATTTCAGAGTC
GGGGTTTCTGCTGCCTCCAGCCCTGTTTGCATGTGCCGGGCCGCGGCGAGGAGCCTCCGC
CCCCCACCCGGTTGTTTTTCGGAGCCTCCCTCTGCTCAGCGTTGGTGGTGGCGGTGGCAG
CATGGCGAGCCCTCCGGAGAGCGATGGCTTCTCGGACGTGCGCAAGGTGGGCTACCTGCG
CAAACCCAAGAGCATGCACAAACGCTTCTTCGTACTGCGCGCGGCCAGCGAGGCTGGGGG
CCCGGCGCGCCTCGAGTACTACGAGAACGAGAAGAAGTGGCGGCACAAGTCGAGCGCCCC
CAAACGCTCGATCCCCCTTGAGAGCTGCTTCAACATCAACAAGCGGGCTGACTCCAAGAA
CAAGCACCTGGTGGCTCTCTACACCCGGGACGAGCACTTTGCCATCGCGGCGGACAGCGA
GGCCGAGCAAGACAGCTGGTACCAGGCTCTCCTACAGCTGCACAACCGTGCTAAGGGCCA
CCACGACGGAGCTGCGGCCCTCGGGGCGGGAGGTGGTGGGGGCAGCTGCAGCGGCAGCTC
CGGCCTTGGTGAGGCTGGGGAGGACTTGAGCTACGGTGACGTGCCCCCAGGACCCGCATT
CAAAGAGGTCTGGCAAGTGATCCTGAAGCCCAAGGGCCTGGGTCAGACAAAGAACCTGAT
TGGTATCTACCGCCTTTGCCTGACCAGCAAGACCATCAGCTTCGTGAAGCTGAACTCGGA
GGCAGCGGCCGTGGTGCTGCAGCTGATGAACATCAGGCGCTGTGGCCACTCGGAAAACTT
CTTCTTCATCGAGGTGGGCCGTTCTGCCGTGACGGGGCCCGGGGAGTTCTGGATGCAGGT
GGATGACTCTGTGGTGGCCCAGAACATGCACGAGACCATCCTGGAGGCCATGCGGGCCAT
GAGTGATGAGTTCCGCCCTCGCAGCAAGAGCCAGTCCTCGTCCAACTGCTCTAACCCCAT
CAGCGTCCCCCTGCGCCGGCACCATCTCAACAATCCCCCGCCCAGCCAGGTGGGGCTGAC
CCGCCGATCACGCACTGAGAGCATCACCGCCACCTCCCCGGCCAGCATGGTGGGCGGGAA
GCCAGGCTCCTTCCGTGTCCGCGCCTCCAGTGACGGCGAAGGCACCATGTCCCGCCCAGC
CTCGGTGGACGGCAGCCCTGTGAGTCCCAGCACCAACAGAACCCACGCCCACCGGCATCG
GGGCAGCGCCCGGCTGCACCCCCCGCTCAACCACAGCCGCTCCATCCCCATGCCGGCTTC
CCGCTGCTCGCCTTCGGCCACCAGCCCGGTCAGTCTGTCGTCCAGTAGCACCAGTGGCCA
TGGCTCCACCTCGGATTGTCTCTTCCCACGGCGATCTAGTGCTTCGGTGTCTGGTTCCCC
CAGCGATGGCGGTTTCATCTCCTCGGATGAGTATGGCTCCAGTCCCTGCGATTTCCGGAG
TTCCTTCCGCAGTGTCACTCCGGATTCCCTGGGCCACACCCCACCAGCCCGCGGTGAGGA
GGAGCTAAGCAACTATATCTGCATGGGTGGCAAGGGGCCCTCCACCCTGACCGCCCCCAA
CGGTCACTACATTTTGTCTCGGGGTGGCAATGGCCACCGCTGCACCCCAGGAACAGGCTT
GGGCACGAGTCCAGCCTTGGCTGGGGATGAAGCAGCCAGTGCTGCAGATCTGGATAATCG
GTTCCGAAAGAGAACTCACTCGGCAGGCACATCCCCTACCATTACCCACCAGAAGACCCC
GTCCCAGTCCTCAGTGGCTTCCATTGAGGAGTACACAGAGATGATGCCTGCCTACCCACC
AGGAGGTGGCAGTGGAGGCCGACTGCCGGGACACAGGCACTCCGCCTTCGTGCCCACCCG
CTCCTACCCAGAGGAGGGTCTGGAAATGCACCCCTTGGAGCGTCGGGGGGGGCACCACCG
CCCAGACAGCTCCACCCTCCACACGGATGATGGCTACATGCCCATGTCCCCAGGGGTGGC
CCCAGTGCCCAGTGGCCGAAAGGGCAGTGGAGACTATATGCCCATGAGCCCCAAGAGCGT
ATCTGCCCCACAGCAGATCATCAATCCCATCAGACGCCATCCCCAGAGAGTGGACCCCAA
TGGCTACATGATGATGTCCCCCAGCGGTGGCTGCTCTCCTGACATTGGAGGTGGCCCCAG
CAGCAGCAGCAGCAGCAGCAACGCCGTCCCTTCCGGGACCAGCTATGGAAAGCTGTGGAC
AAACGGGGTAGGGGGCCACCACTCTCATGTCTTGCCTCACCCCAAACCCCCAGTGGAGAG
CAGCGGTGGTAAGCTCTTACCTTGCACAGGTGACTACATGAACATGTCACCAGTGGGGGA
CTCCAACACCAGCAGCCCCTCCGACTGCTACTACGGCCCTGAGGACCCCCAGCACAAGCC
AGTCCTCTCCTACTACTCATTGCCAAGATCCTTTAAGCACACCCAGCGCCCCGGGGAGCC
GGAGGAGGGTGCCCGGCATCAGCACCTCCGCCTTTCCACTAGCTCTGGTCGCCTTCTCTA
TGCTGCAACAGCAGATGATTCTTCCTCTTCCACCAGCAGCGACAGCCTGGGTGGGGGATA
CTGCGGGGCTAGGCTGGAGCCCAGCCTTCCACATCCCCACCATCAGGTTCTGCAGCCCCA
TCTGCCTCGAAAGGTGGACACAGCTGCTCAGACCAATAGCCGCCTGGCCCGGCCCACGAG
GCTGTCCCTGGGGGATCCCAAGGCCAGCACCTTACCTCGGGCCCGAGAGCAGCAGCAGCA
GCAGCAGCCCTTGCTGCACCCTCCAGAGCCCAAGAGCCCGGGGGAATATGTCAATATTGA
ATTTGGGAGTGATCAGTCTGGCTACTTGTCTGGCCCGGTGGCTTTCCACAGCTCACCTTC
TGTCAGGTGTCCATCCCAGCTCCAGCCAGCTCCCAGAGAGGAAGAGACTGGCACTGAGGA
GTACATGAAGATGGACCTGGGGCCGGGCCGGAGGGCAGCCTGGCAGGAGAGCACTGGGGT
CGAGATGGGCAGACTGGGCCCTGCACCTCCCGGGGCTGCTAGCATTTGCAGGCCTACCCG
GGCAGTGCCCAGCAGCCGGGGTGACTACATGACCATGCAGATGAGTTGTCCCCGTCAGAG
CTACGTGGACACCTCGCCAGCTGCCCCTGTAAGCTATGCTGACATGCGAACAGGCATTGC
TGCAGAGGAGGTGAGCCTGCCCAGGGCCACCATGGCTGCTGCCTCCTCATCCTCAGCAGC
CTCTGCTTCCCCGACTGGGCCTCAAGGGGCAGCAGAGCTGGCTGCCCACTCGTCCCTGCT
GGGGGGCCCACAAGGACCTGGGGGCATGAGCGCCTTCACCCGGGTGAACCTCAGTCCTAA
CCGCAACCAGAGTGCCAAAGTGATCCGTGCAGACCCACAAGGGTGCCGGCGGAGGCATAG
CTCCGAGACTTTCTCCTCAACACCCAGTGCCACCCGGGTGGGCAACACAGTGCCCTTTGG
AGCGGGGGCAGCAGTAGGGGGCGGTGGCGGTAGCAGCAGCAGCAGCGAGGATGTGAAACG
CCACAGCTCTGCTTCCTTTGAGAATGTGTGGCTGAGGCCTGGGGAGCTTGGGGGAGCCCC
CAAGGAGCCAGCCAAACTGTGTGGGGCTGCTGGGGGTTTGGAGAATGGTCTTAACTACAT
AGACCTGGATTTGGTCAAGGACTTCAAACAGTGCCCTCAGGAGTGCACCCCTGAACCGCA
GCCTCCCCCACCCCCACCCCCTCATCAACCCCTGGGCAGCGGTGAGAGCAGCTCCACCCG
CCGCTCAAGTGAGGATTTAAGCGCCTATGCCAGCATCAGTTTCCAGAAGCAGCCAGAGGA
CCGTCAGTAGCTCAACTGGACATCACAGCAG
gtgcgtttcatggtgacaaagtcagaagacaaaactgcttttaaccttgtccttgaattc
tgttcttcgcctctgccccttcctgttctttcccactgcttcctcagggagaatgcactt
acattctcagggcacacaagatgctcaccccacactgacatctggcagagagtcaaacaa
EXON 2  1029 bp
gcattttgaaataaataaaaagctaaatacagtttgttgatcatatttaggtggacagta
ctatttgtgcctgtaacttcagtttatgtgacgctgccccttgtaaaagaaaggttctaa
agtagtgattgtgcagtttgagatacctgtggtgctgaattctttcctttttcttttcag
AATGAAGACCTAAATGACCTCAGCAAATCCTCTTCTAACTCATGGGTACCCAGACTCTAA
ATATTTCATGATTCACAACTAGGACCTCATATCTTCCTCATCAGTAGATGGTACGATGCA
TCCATTTCAGTTTGTTTACTTTATCCAATCCTCAGGATTTCATTGACTGAACTGCACGTT
CTATATTGTGCCAAGCGAAAAAAAAAAATGCACTGTGACACCAGAATAATGAGTCTGCAT
AAACTTCATCTTCAACCTTAAGGACTTAGCTGGCCACAGTGAGCTGATGTGCCCACCACC
GTGTCATGAGAGAATGGGTTTACTCTCAATGCATTTTCAAGATACATTTCATCTGCTGCT
GAAACTGTGTACGACAAAGCATCATTGTAAATTATTTCATACAAAACTGTTCACGTTGGG
TGGAGAGAGTATTAAATATTTAACATAGGTTTTGATTTATATGTGTAATTTTTTAAATGA
AAATGTAACTTTTCTTACAGCACATCTTTTTTTTGGATGTGGGATGGAGGTATACAATGT
TCTGTTGTAAAGAGTGGAGCAAATGCTTAAAACAAGGCTTAAAAGAGTAGAATAGGGTAT
GATCCTTGTTTTAAGATTGTAATTCAGAAAACATAATATAAGAATCATAGTGCCATAGAT
GGTTCTCAATTGTATAGTTATATTTGCTGATACTATCTCTTGTCATATAAACCTGATGTT
GAGCTGAGTTCCTTATAAGAATTAATCTTAATTTTGTATTTTTTCCTGTAAGACAATAGG
CCATGTTAATTAAACTGAAGAAGGATATATTTGGCTGGGTGTTTTCAAATGTCAGCTTAA
AATTGGTAATTGAATGGAAGCAAAATTATAAGAAGAGGAAATTAAAGTCTTCCATTGCAT
GTATTGTAAACAGAAGGAGATGGGTGATTCCTTCAATTCAAAAGCTCTCTTTGGAATGAA
CAATGTGGGCGTTTGTAAATTCTGGAAATGTCTTTCTATTCATAATAAACTAGATACTGT
TGATCTTTT
cttctgtcccctccccccaccacttctgtaagtttcctgctctattcccaccattttttt
ctgtgcacacattatgatatatttcatttcctgcattgtcttgagaaagatggtaaggca
agtgagctgttgctaaccagaaattaaaattccagtaagtgtttttcattatgaccaggg