Gene IL1F7 Variant 5
DNA : 3.69 KbNT_022135
mRNA : 649 bp NM_173205
CDS : 579 bp NP_775297
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  67 bp
tggcactgatgttactgctgctgttggagtacaacttccctatagaaaacaactgccagc
accttaagaccactcacaccttcagagtggccttgagaaagatttggggtcaaggatcat
gagcgagaacaccacttaagaggatagtgaactagtctgcatgtgagacgctgagatcct
ATGTCAGGCTGTGATAGGAGGGAAACAGAAACCAAAGGAAAGAACAGCTTTAAGAAGCGC
TTAAGAG
gtacaaagtaaaatgatggtgctagaaaagtagcttcttaaaaagagcattttccagtct
caccctggactaactgaatgagaatctcaggagtgtgaggcccaggtatccatggtctta
aaatgccacccaccaggtgattcccagtgtgcaccaggggtgagagtcacagccttaggc
EXON 2  120 bp
cttaattgcttgtcccagcaagatagaaagcctgggagtggaagaaatattcagtggctg
tgatgtctgagcccacaggcagggtggagagctagggctggggcccttggacgtggggaa
gaaagggctgagtcttccattttcaatgtgaagtgttgatatctggtgatattgatctag
GTCCAAAGGTGAAGAACTTAAACCCGAAGAAATTCAGCATTCATGACCAGGATCACAAAG
TACTGGTCCTGGACTCTGGGAATCTCATAGCAGTTCCAGATAAAAACTACATACGCCCAG

gtgactctcagttttggctgtgttttctgcctccacctagcaggggtaaggcctcctgct
aggtgggctcaactccatgctataccatgccccatctccagcaggtggtggaagcgagga
ggagaggccccagggactagggcatcagatgaagggtctctagcaatgaccagatctgaa
EXON 3  143 bp
aaaagaaggaggcagacacttagactggaagaagaggaggcttaaaccagtgtgatggag
ggagaagtggaccacagagtcaagggagagggactgtgcatcaggcctgaaaccccagca
gacaggagagacctttccctgctctcagaacccacacatgttctgactgtctttttccag
AGATCTTCTTTGCATTAGCCTCATCCTTGAGCTCAGCCTCTGCGGAGAAAGGAAGTCCGA
TTCTCCTGGGGGTCTCTAAAGGGGAGTTTTGTCTCTACTGTGACAAGGATAAAGGACAAA
GTCATCCATCCCTTCAGCTGAAG
gtgagagttctagctcagtttcctgggcctttggctaccccaaagtaaaaggccaagatc
ctcaatgcctctcgctttcctgcaaattcttatcttggccaatataacagggacatccac
ctttctggaagcaccaggcagaagagccccataacttcttctctggttccttgccccttc
EXON 4  319 bp
aggattgcttatcatcccttaaataccagtaccaaggctgacacgtcatctttcccaagg
accatctgccttctctcttttcctcctctcctgtgtaaaggcctggaggatgagcacatg
tgctgtgttttcctccctctcaaagcctgtgctatctaattaatcccttttacctcacag
AAGGAGAAACTGATGAAGCTGGCTGCCCAAAAGGAATCAGCACGCCGGCCCTTCATCTTT
TATAGGGCTCAGGTGGGCTCCTGGAACATGCTGGAGTCGGCGGCTCACCCCGGATGGTTC
ATCTGCACCTCCTGCAATTGTAATGAGCCTGTTGGGGTGACAGATAAATTTGAGAACAGG
AAACACATTGAATTTTCATTTCAACCAGTTTGCAAAGCTGAAATGAGCCCCAGTGAGGTC
AGCGATTAGGAAACTGCCCCATTGAACGCCTTCCTCGCTAATTTGAACTAATTGTATAAA
AACACCAAACCTGCTCACT
aaactttctgtcattgggtttcatttctcattcatgctttaaggatttgtgtttttagga
tatagcaagaagcttgtttaattacaaagttctgggttggaaagagaccggcttctgctt
gtgtactgctaccctgaaccatcagacatgcatgtgtgtgtcatatgctatgatgtggcc