Gene IL1F7 Variant 4
DNA : 5.91 KbNT_022135
mRNA : 586 bp NM_173203
CDS : 474 bp NP_775295
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  124 bp
ttgaaggcgtgatagacaggagagcatggtctggccccttggtgcctttctggttgcagc
gagcatttcaaactacagagcaaggccagtggtctgttcagcactagagacatgcagcaa
ggtgtcctggggtgagaagatgccataactggtcccctttctatctccttaggtcttgga
CTTCATTCCATTTTCTGTTGAGTAATAAACTCAACGTTGAAAATGTCCTTTGTGGGGGAG
AACTCAGGAGTGAAAATGGGCTCTGAGGACTGGGAAAAAGATGAACCCCAGTGCTGCTTA
GAAG
gtaaggttcttgtagaaatctacctcagggccaaagtgtaattcctagagcagaactttg
ctaggtgctgtgcacagacccagttgtttcctgctgacttgcacagtaagtgagctttca
aatttccctggacaaataactagacaagagaaattctggaagggaaaaggaagctttgct
EXON 2  143 bp
aaaagaaggaggcagacacttagactggaagaagaggaggcttaaaccagtgtgatggag
ggagaagtggaccacagagtcaagggagagggactgtgcatcaggcctgaaaccccagca
gacaggagagacctttccctgctctcagaacccacacatgttctgactgtctttttccag
AGATCTTCTTTGCATTAGCCTCATCCTTGAGCTCAGCCTCTGCGGAGAAAGGAAGTCCGA
TTCTCCTGGGGGTCTCTAAAGGGGAGTTTTGTCTCTACTGTGACAAGGATAAAGGACAAA
GTCATCCATCCCTTCAGCTGAAG
gtgagagttctagctcagtttcctgggcctttggctaccccaaagtaaaaggccaagatc
ctcaatgcctctcgctttcctgcaaattcttatcttggccaatataacagggacatccac
ctttctggaagcaccaggcagaagagccccataacttcttctctggttccttgccccttc
EXON 3  319 bp
aggattgcttatcatcccttaaataccagtaccaaggctgacacgtcatctttcccaagg
accatctgccttctctcttttcctcctctcctgtgtaaaggcctggaggatgagcacatg
tgctgtgttttcctccctctcaaagcctgtgctatctaattaatcccttttacctcacag
AAGGAGAAACTGATGAAGCTGGCTGCCCAAAAGGAATCAGCACGCCGGCCCTTCATCTTT
TATAGGGCTCAGGTGGGCTCCTGGAACATGCTGGAGTCGGCGGCTCACCCCGGATGGTTC
ATCTGCACCTCCTGCAATTGTAATGAGCCTGTTGGGGTGACAGATAAATTTGAGAACAGG
AAACACATTGAATTTTCATTTCAACCAGTTTGCAAAGCTGAAATGAGCCCCAGTGAGGTC
AGCGATTAGGAAACTGCCCCATTGAACGCCTTCCTCGCTAATTTGAACTAATTGTATAAA
AACACCAAACCTGCTCACT
aaactttctgtcattgggtttcatttctcattcatgctttaaggatttgtgtttttagga
tatagcaagaagcttgtttaattacaaagttctgggttggaaagagaccggcttctgctt
gtgtactgctaccctgaaccatcagacatgcatgtgtgtgtcatatgctatgatgtggcc