Gene IL1F7 Variant 1
DNA : 5.91 KbNT_022135
mRNA : 769 bp NM_014439
CDS : 657 bp NP_055254
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  124 bp
ttgaaggcgtgatagacaggagagcatggtctggccccttggtgcctttctggttgcagc
gagcatttcaaactacagagcaaggccagtggtctgttcagcactagagacatgcagcaa
ggtgtcctggggtgagaagatgccataactggtcccctttctatctccttaggtcttgga
CTTCATTCCATTTTCTGTTGAGTAATAAACTCAACGTTGAAAATGTCCTTTGTGGGGGAG
AACTCAGGAGTGAAAATGGGCTCTGAGGACTGGGAAAAAGATGAACCCCAGTGCTGCTTA
GAAG
gtaaggttcttgtagaaatctacctcagggccaaagtgtaattcctagagcagaactttg
ctaggtgctgtgcacagacccagttgtttcctgctgacttgcacagtaagtgagctttca
aatttccctggacaaataactagacaagagaaattctggaagggaaaaggaagctttgct
EXON 2  63 bp
tccagttcatctctattctatgtttctgaagagggaagctatgatttaatgtcattacta
tcatgctgctctagtatttctcagcacatacacagaagagggaattaaatggtctttgat
acccctaaatccttggaaaatccgaattgcatatgctaacctcactgcgtctgactgcag
ACCCGGCTGGAAGCCCCCTGGAACCAGGCCCAAGCCTCCCCACCATGAATTTTGTTCACA
CAA
gtaaggcctcggggtgaggtgatgggggtggctgaggtgcgagggtggggatgggggatg
gagccattgggtcctcttacagggtgggagaattgtagaatggggacacctaagggtgct
ggatggggctgaagtctttcctttgtggaagcaaatcccattaggagataactctgggaa
EXON 3  120 bp
cttaattgcttgtcccagcaagatagaaagcctgggagtggaagaaatattcagtggctg
tgatgtctgagcccacaggcagggtggagagctagggctggggcccttggacgtggggaa
gaaagggctgagtcttccattttcaatgtgaagtgttgatatctggtgatattgatctag
GTCCAAAGGTGAAGAACTTAAACCCGAAGAAATTCAGCATTCATGACCAGGATCACAAAG
TACTGGTCCTGGACTCTGGGAATCTCATAGCAGTTCCAGATAAAAACTACATACGCCCAG

gtgactctcagttttggctgtgttttctgcctccacctagcaggggtaaggcctcctgct
aggtgggctcaactccatgctataccatgccccatctccagcaggtggtggaagcgagga
ggagaggccccagggactagggcatcagatgaagggtctctagcaatgaccagatctgaa
EXON 4  143 bp
aaaagaaggaggcagacacttagactggaagaagaggaggcttaaaccagtgtgatggag
ggagaagtggaccacagagtcaagggagagggactgtgcatcaggcctgaaaccccagca
gacaggagagacctttccctgctctcagaacccacacatgttctgactgtctttttccag
AGATCTTCTTTGCATTAGCCTCATCCTTGAGCTCAGCCTCTGCGGAGAAAGGAAGTCCGA
TTCTCCTGGGGGTCTCTAAAGGGGAGTTTTGTCTCTACTGTGACAAGGATAAAGGACAAA
GTCATCCATCCCTTCAGCTGAAG
gtgagagttctagctcagtttcctgggcctttggctaccccaaagtaaaaggccaagatc
ctcaatgcctctcgctttcctgcaaattcttatcttggccaatataacagggacatccac
ctttctggaagcaccaggcagaagagccccataacttcttctctggttccttgccccttc
EXON 5  319 bp
aggattgcttatcatcccttaaataccagtaccaaggctgacacgtcatctttcccaagg
accatctgccttctctcttttcctcctctcctgtgtaaaggcctggaggatgagcacatg
tgctgtgttttcctccctctcaaagcctgtgctatctaattaatcccttttacctcacag
AAGGAGAAACTGATGAAGCTGGCTGCCCAAAAGGAATCAGCACGCCGGCCCTTCATCTTT
TATAGGGCTCAGGTGGGCTCCTGGAACATGCTGGAGTCGGCGGCTCACCCCGGATGGTTC
ATCTGCACCTCCTGCAATTGTAATGAGCCTGTTGGGGTGACAGATAAATTTGAGAACAGG
AAACACATTGAATTTTCATTTCAACCAGTTTGCAAAGCTGAAATGAGCCCCAGTGAGGTC
AGCGATTAGGAAACTGCCCCATTGAACGCCTTCCTCGCTAATTTGAACTAATTGTATAAA
AACACCAAACCTGCTCACT
aaactttctgtcattgggtttcatttctcattcatgctttaaggatttgtgtttttagga
tatagcaagaagcttgtttaattacaaagttctgggttggaaagagaccggcttctgctt
gtgtactgctaccctgaaccatcagacatgcatgtgtgtgtcatatgctatgatgtggcc