Gene IL18R1 Variant 1
DNA : 36.12 KbNT_022171
mRNA : 3522 bp NM_003855
CDS : 1626 bp NP_003846
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  82 bp
tttattaattttatatggctgaaagttctgagaattggttactatattaaggattataaa
aatcttctaggttgtttttttaaaaatctgtgtgccagaagatttttaaaccttcataag
ataggcacacttttgtttgaaagctttggctgaatctgttttattctgttttccagagaa
GCCATTTGAAGCAGAATCCAAACCATGAATTGTAGAGAATTACCCTTGACCCTTTGGGTG
CTTATATCTGTAAGCACTGCAG
gtaagtgattatacatactctcaaacatatttcatgagtaattgaggaagaatgtcaaag
tttttttttttatgtggtggctactgaagatgctgaatttattcagaaaagaaaagattc
tgcagtctgagttcatgtagtgagagcagagtgaaaaacttgcatcttgaaataaattac
EXON 2  244 bp
ctttctagtgttggaaagattgacgcaaaaataaagaacccacaggaaattgacaccgag
atttctcaggactttcttgctaaccttgcttcttcacctaatgcattaggagaccaaaaa
aagttaccttgtcattttggtttttgtttttatttattttactttactaatcttttgaag
AATCTTGTACTTCACGTCCCCACATTACTGTGGTTGAAGGGGAACCTTTCTATCTGAAAC
ATTGCTCGTGTTCACTTGCACATGAGATTGAAACAACCACCAAAAGCTGGTACAAAAGCA
GTGGATCACAGGAACATGTGGAGCTGAACCCAAGGAGTTCCTCGAGAATTGCTTTGCATG
ATTGTGTTTTGGAGTTTTGGCCAGTTGAGTTGAATGACACAGGATCTTACTTTTTCCAAA
TGAA
gtgagtaaccctttcttttcaaaatgtatttcacagccctcttgtcctttgttcagcaac
tcaaatatgcagtaatctgaaaggtcagataatcaccacatccttttctttcctactctt
cctatgacatgaaatacattctttgttatggaacagaataagtttatctctctctgctta
EXON 3  166 bp
tttttaaagttcttgctcttctgaatcaagcggaggcagagcagggtttgcacatcaatg
aatcaatctctttaataaaaataaaggaaaaatattgtaactggttactaaagggaagat
gggtgatatttgcaaagtttctgtagcattataaaatacctttacacttttattccatag
AAATTATACTCAGAAATGGAAATTAAATGTCATCAGAAGAAATAAACACAGCTGTTTCAC
TGAAAGACAAGTAACTAGTAAAATTGTGGAAGTTAAAAAATTTTTTCAGATAACCTGTGA
AAACAGTTACTATCAAACACTGGTCAACAGCACATCATTGTATAAG
gtaatgcttttataatattttaactttaagacttgatggaaaagataaaattcccaaatg
aggggctgagagctaccattctggtctcataacaaataagctgcctgatcccacatggct
cacttgccctgtttgagccaagtatcctcactggcttgttgtcaagagctgatacatagt
EXON 4  157 bp
ggatcgcatttaattgtttcagtaaaagtagtaccaagtaactgggacatatgtccagga
attgctactttccattcttttttcctttttctctaaagatctttaactcaaaaatttgga
tcactgtaatatcaatttggcttttacttaaagtattttaacttgttttattaaaaacag
AACTGTAAAAAGCTACTACTGGAGAACAATAAAAACCCAACGATAAAGAAGAACGCCGAG
TTTGAAGATCAGGGGTATTACTCCTGCGTGCATTTCCTTCATCATAATGGAAAACTATTT
AATATCACCAAAACCTTCAATATAACAATAGTGGAAG
gtaagggaaatcttagaattgggaagaaacagacgtattttagtaaaatggaattttttc
attcttcaaaactgtgtaggaattgagagtccacttagttggggttgtgaccacaccact
agttcaaatatgatggtcaaaatcttcattctggtgctcctctacttggctaaataaacc
EXON 5  63 bp
cagatacaaggtgctttcaacatctgtgacctttagttaatgcaaataggactcaagtga
acgtaaaccagtaactattggaatctttgttacatgaaatgagcatattatcatagatgc
ttgtcataaagaagctcaaggcaacactaatacatttgtcttttcttttgtcacttctag
ATCGCAGTAATATAGTTCCGGTTCTTCTTGGACCAAAGCTTAACCATGTTGCAGTGGAAT
TAG
gtatatttcaatatacatatattctgcatttataagtaggggacataatagagccttcca
agcgtaaatatgattcattattgaatgacactggatacacatttcatatttactgaataa
cattacaaaactaagaaaagagtgccattttttgaatgttgccacttttaacctgactta
EXON 6  121 bp
tgctacctatttcttctgctttatatattttgttttatttaaagcaaggcatatttattc
tctttctgggatggagcaccacgttttgctttaggttaacatacattgattatattgttt
tgaaacttttaagaaacctgagtttcaaaaatcagaactttagttgccaacttttaccag
GAAAAAACGTAAGGCTCAACTGCTCTGCTTTGCTGAATGAAGAGGATGTAATTTATTGGA
TGTTCGGGGAAGAAAATGGATCGGATCCTAATATACATGAAGAGAAAGAAATGAGAATTA
T
gtatgtatgtgtaatatatatgtcatgatatataccatataacaatcatatatattatat
ataacatcatattaaaaacactgggtggctgatgtgtattttgggctagtttaaattata
attataatggacatattttataattatagtggccataccctaggtggacgcattatgcag
EXON 7  140 bp
ttctgatgctccacggaggaggggacgtttattgtagtccatgctttaagagtactggcc
agaaagggaagaaataatgcaggcaacatcacagctgccttcaagcattttaaacatgtg
aattcccctctcaagggtaacgaacagagcctactgctaaattattttgccctcttacag
GACTCCAGAAGGCAAATGGCATGCTTCAAAAGTATTGAGAATTGAAAATATTGGTGAAAG
CAATCTAAATGTTTTATATAATTGCACTGTGGCCAGCACGGGAGGCACAGACACCAAAAG
CTTCATCTTGGTGAGAAAAG
gtgagaaagatttatttttggaagttttgaaacttagctcattgctactgagagacattt
caaagatggccactttctcattttccacaccagaacccagctcctgagaggggaaatcag
tcacctcatgtcacaggcattcagtggggcccctctgtctcatgatgccaagcagagaat
EXON 8  162 bp
gaaatatcactactccagactaaaggcaggaatgtggagtcactcagtggaatgtgtcag
cacgtgggttggcaactactgcattagtgttagcagtaaaaatggacaagcacgtgatga
tggacaacactggtaagatttcttgattattttcttttcctttttccctttcttttctag
CAGACATGGCTGATATCCCAGGCCACGTCTTCACAAGAGGAATGATCATAGCTGTTTTGA
TCTTGGTGGCAGTAGTGTGCCTAGTGACTGTGTGTGTCATTTATAGAGTTGACTTGGTTC
TATTTTATAGACATTTAACGAGAAGAGATGAAACATTAACAG
gtaacacatataatgctggaatttcttaccttatgttctcattaagaaatcagataaata
ggcattaatcttcatcttattgtgatgatattgtagaattaatctgtgggagaggttttc
tatgggaaatattgttctgcctgtaccatccattatgaatgttgtctatgtcttcttttc
EXON 9  159 bp
ttaaaaacacattggctaattggttgcttggttagcatgggaggtttaaatataaacaac
tttatatataatttgttttttcaatgattctatactcattacttacgacattcacttaag
tttgtacttaaataaaattttatttacacatgaattaaaagagccaatcttacctcctag
ATGGAAAAACATATGATGCTTTTGTGTCTTACCTAAAAGAATGCCGACCTGAAAATGGAG
AGGAGCACACCTTTGCTGTGGAGATTTTGCCCAGGGTGTTGGAGAAACATTTTGGGTATA
AGTTATGCATATTTGAAAGGGATGTAGTGCCTGGAGGAG
gtaagagggaatgccagatagaaaaatattcaagatagtttctttttaaaaaatgaatga
gctagcccccagagagctatcccattttccttaaaaacaaatgaataaggtcctttaagc
aagaaataaccacgtaagtcaacaatcgatagtgagaaaacaaactaatgagcttccaat
EXON 10  2228 bp
tattgttacctagagattttttaataagcatataaaattaagaacaaatggtttgtctta
aagaaaaacttattagtgaggttaggagttaatataaaataagactgtgcaaaatgactt
ttatctcatgttccccctttcagttatcttaaattaataggggttatcttgcattttcag
CTGTTGTTGATGAAATCCACTCACTGATAGAGAAAAGCCGAAGACTAATCATTGTCCTAA
GTAAAAGTTATATGTCTAATGAGGTCAGGTATGAACTTGAAAGTGGACTCCATGAAGCAT
TGGTGGAAAGAAAAATTAAAATAATCTTAATTGAATTTACACCTGTTACTGACTTCACAT
TCTTGCCCCAATCACTAAAGCTTTTGAAATCTCACAGAGTTCTGAAGTGGAAGGCCGATA
AATCTCTTTCTTATAACTCAAGGTTCTGGAAGAACCTTCTTTACTTAATGCCTGCAAAAA
CAGTCAAGCCAGGTAGAGACGAACCGGAAGTCTTGCCTGTTCTTTCCGAGTCTTAATCTT
CAGAAACAGTGAACGCCAAAAAGAACTCAAGATATTCTGGGGACTGAGCATATGAACCTG
TTCATAACAAAGGCTGTGACTCGAAATAATTAACTTTGTCAAAATCCTGCTCACAATTTG
AAGATGAAACTTGTCATTAGGTTGGCGGGAATGAGACTAAAGATTGCGCTGTGGGCTGTG
GTCACGTGCTCCCAGAAGACCTGGAATTCAAAAGAAATGGAGCTATTCTTTTTCTCCCTC
TTTCATAACTGGATGCAGCTGCTCATACTCAATCCCATATTCAGCAAGTGTGAAGCTGGA
CGTGATGCAAAATAACCGATGCCCTACAAAAAGGGCGCATCTTTAAGAGTTTTAATGCCA
GTGCTTAATTCGAATGAGGGGATTTTAAGTGTCTGAAGAGGCATTTTCTAGGGACCAGTG
GGTGACTGAGTAACTGAAATGCTGCTTTCACTCCCTAACACCATGGATCTGGTTGTGCAT
AGGATGTGGGAGGAGGGGCTGGCAGGGCCGCCTTCAGAGGCTGCAGGGCCTCAGCCTCAG
GATGCATTTAATGTATCCTGGCCACAGTTGCAGCCAACGGTTCTTGAAAGCTCGGTAAGG
CCCTGCAACGCAGAGCCTGCTTATGTGGATCTATTTATGGGAACTTCTTAAAAGGACCCC
AGAATAGCTCTTTATCTTTCACAAGAGACACAAATTCTAATTGAGTTAATTATCTGGGCC
TTTCACTTTGGATGCTCTGAAACATTTGTTGATTTTGTGTGAATGTTTATATCAAAATGT
TTGCCAGGTTGTATTAGCCATTGAATAGCAAAAAACTGATAGTTACTTGCTTGTTTTTTA
AAAATTACATATTAAAAATGCCCTTGGCATAAGGCAGCATGGTGTGGCAGTTAAGAGATG
GGCTGTGCAGCCCATCCTGAGCTCCAGTCCTGAGTTTGCTACTTACTTCTGTGGCCTCTG
GAACCTTATCCAACCTCTTGGTGCTTCAGTTTCCTCATCTGTGAAATTAGAATTTATAAT
AATTGCACCTACCTCCCAGGGGTAACTAAATGAATAAATATAATAAAGTACTTACAGTGG
TTCCTGACACAGACTCAGCACTCCGTCAGTGTTGCCATGACTATTTTTATTATCATTATT
AATGATTACTTAGATCAATTATTTAGCAGTGGACTAATGGAAGCTACAGAGCAGGGAAGG
GAAGCAGATCTAGGGAGGAAGGCAGTTTTGATTTGAGGAGGTTTGCACATGTAGAGAAGC
ATACTGGAGAAGCATATCCAGAGGGCGAAAGATATCTCTCCATTGTGCATCTGCCTCTTT
TGACGTTGGAAGACACATGTCTTACCCCCCAAAGGGAGCCCAGCACTGGGAGCCTTCTTG
ATGATCTCAAAAATAATAGCTATTCAAGAAAATCACCAAGTGACTGTGAAACCGTCAGTT
CGGAAGGCTGGTTAGAACATGTGGGAGCAACATGAATGTTCTACAAAAGTTTAAAGCAGA
GATTGTTTCAAATGGGTGTAGTAGATATTACTGAAAACCAAAAAAGAGTGAGATTGTCAG
TGTAAGAATGTGATTTAATGTTTGTAGTGCTTACAATTTTGTGTACCAACTGGATGACTA
AAAAGAGTAAAATAATTTAATTAATAGCTCATATTTTATGTGTGAAAACATGTTAGTGAA
CATATATAATCAAAATAGATTTCATTGCTATTGCATAGTCTCTAATACATAGAATGATTT
TGCTTTTCTCTTTTATTATACTTGCTTTAAAATACTTGAAATATATTTTGCATTAAATGC
ATTTCAAGTTAAATGTCTTAAATGTATACATTAGATGTGTGTTTTAAAATGCATAAAACA
CGTTGAAA
tacattaatgaaccattagtctaatgcctttatttttgaaatatcatgacgtctttttca
cttactttaagattccaattcctcgttcttaacatagactcctacctgttttaatagaat
atgggccattcaaaatgaattcatgcacctctctctttttaaatgtcaaattgccttgca