Gene HES6 Variant 1
DNA : 1.76 KbNT_005120
mRNA : 1357 bp NM_018645
CDS : 675 bp NP_061115
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  205 bp
cgcctagctcagccagctgcccgaccgccagagccgctgggccggacaaagcgcgctgcc
ccgattggctgcagcgcgcctcgcggtcggccgccccgggcccgcgcggccaatcggcgc
attgagatgcaaataagcggctataaaaggggcgggaccgcggcgggccggaagccgcga
GGAGCGCGGACGGCTGGGCTGCTGCTGGGCGGCCGCGGGGCAGCGGAGGGCGCCGGCACT
CCGGTCCCCGCCGCTCCCCGTCCCCGCTGCTCCTAGCCCCTGCCGCGTCCCCGGCGGAGC
GGGCATGGCGCCACCCGCGGCGCCTGGCCGGGACCGTGTGGGCCGTGAGGATGAGGACGG
CTGGGAGACGCGAGGGGACCGCAAG
gtgcgggccggggccatgggcgagcaagcgggcgggaggccgtgcggggctgggattcag
tgccccgctccccgcaggcccggaagcccctggtggagaagaagcggcgcgcgcggatca
acgagagcctgcaggagctgcggctgctgctggcgggcgccgaggtgcggcggccgggca
EXON 2  87 bp
ccgcgtccccggcggagcgggcatggcgccacccgcggcgcctggccgggaccgtgtggg
ccgtgaggatgaggacggctgggagacgcgaggggaccgcaaggtgcgggccggggccat
gggcgagcaagcgggcgggaggccgtgcggggctgggattcagtgccccgctccccgcag
GCCCGGAAGCCCCTGGTGGAGAAGAAGCGGCGCGCGCGGATCAACGAGAGCCTGCAGGAG
CTGCGGCTGCTGCTGGCGGGCGCCGAG
gtgcggcggccgggcaggcgccgtggggctgcggggcgggcgggcgggtccgggagcgcg
ctgccggctcaccgcccttcccgcccgcgcaggtgcaggccaagctggagaacgccgaag
tgctggagctgacggtgcggcgggtccagggtgtgctgcggggccgggcgcgcggtgagt
EXON 3  82 bp
ggcccggaagcccctggtggagaagaagcggcgcgcgcggatcaacgagagcctgcagga
gctgcggctgctgctggcgggcgccgaggtgcggcggccgggcaggcgccgtggggctgc
ggggcgggcgggcgggtccgggagcgcgctgccggctcaccgcccttcccgcccgcgcag
GTGCAGGCCAAGCTGGAGAACGCCGAAGTGCTGGAGCTGACGGTGCGGCGGGTCCAGGGT
GTGCTGCGGGGCCGGGCGCGCG
gtgagtggcggcggggcgggcgggggcgccggccgcgggcgcctgtaacccctgccagac
ggaggacttccctcccggcgcccctgtcctgtcggcggcgagggctcccaccggagcagg
gtgcgcccccgcgtctcctgggtgagccgcgtccccgcgggccgggtgggctgggccacg
EXON 4  983 bp
cagacggaggacttccctcccggcgcccctgtcctgtcggcggcgagggctcccaccgga
gcagggtgcgcccccgcgtctcctgggtgagccgcgtccccgcgggccgggtgggctggg
ccacgcagtcgccgctcaccgcgcgggacgcggctctctccctcccaccctcgggcccag
AGCGCGAGCAGCTGCAGGCGGAAGCGAGCGAGCGCTTCGCTGCCGGCTACATCCAGTGCA
TGCACGAGGTGCACACGTTCGTGTCCACGTGCCAGGCCATCGACGCTACCGTCGCTGCCG
AGCTCCTGAACCATCTGCTCGAGTCCATGCCGCTGCGTGAGGGCAGCAGCTTCCAGGATC
TGCTGGGGGACGCCCTGGCGGGGCCACCTAGAGCCCCTGGACGGAGTGGCTGGCCTGCGG
GGGGCGCTCCGGGATCCCCAATACCCAGCCCCCCGGGTCCTGGGGACGACCTGTGCTCCG
ACCTGGAGGAGGCCCCTGAGGCTGAACTGAGTCAGGCTCCTGCTGAGGGGCCCGACTTGG
TGCCCGCAGCCCTGGGCAGCCTGACCACAGCCCAAATTGCCCGGAGTGTCTGGAGGCCTT
GGTGACCAATGCCAGCCAGAGTCCTGCGGGGGTGGGCCCGGCCCTCCCTGGATCTCCTCC
CTCCTCCCAGGGGTTCAGATGTGGTGGGGTAGGGCCCTGGAAGTCTCCCAGGTCTTCCCT
CCCTCCTCTGATGGATGGCTTGCAGGGCAGCCCCTGGTAACCAGCCCAGTCAGGCCCCAG
CCCCGTTTCTTAAGAAACTTTTAGGGACCCTGCAGCTCTGGAGTGGGTGGAGGGAGGGAG
CTACGGGCAGGAGGAAGAATTTTGTAGAGCTGCCAGCGCTCTCCCAGGTTCACCCACCCA
GGCTTCACCAGCCCTGTGCGGGCTCTGGGGGCAGAGGTGGCAGAAATGGTGCTGGGCACT
AGTGTTCCAGGCAGCCCTGGGCTAAACAAAAGCTTGAACTTGCCACTTCAGCGGGGAGAT
GAGAGGCAGGTGCACTGAGCTGCACTGCCCAGAGCTGTGATGCTCTGTACATCTTGTTTG
TAGCACACTTGAGTTTGTGTATTCCATTGACATCAAATGTGACAATTTTACTAAATAAAG
AATTTTGGAGTTAGTTACCCTTG
aagtattgttgagtgatgtgtcattactgtgtcaagatatgtaaatgctaaactaagcac
atttcccctgcatctgaggctggtgaatgtcctttaaaacctcaccctttctcagcagag
tgagcagtgtgatggtggtggggatgcactccgtggctgtctctgcagcaggcagtgctt