Gene HDLBP Variant 1
DNA : 39.33 KbNT_005416
mRNA : 4295 bp NM_005336
CDS : 3807 bp NP_005327
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  65 bp
tcaagctaacgttttttttttcttccaagaaacttgcctgagtattggtgttagtaacca
aagcataaatatcttgaccttttctgattttgaggtaaaaagatctgagttgtaaaatgt
agataagtaacttttctctggtttcctctctctcctctcccacttcccatcccataccag
CAAAAGCTGGCAGGCTGACAGAGGCGGCCTCAGGACGGACCTTCTGGCTACTGACCGTTT
TGCTG
gtaagtttgaccctgtctgaagacttcctgtccctgggctgtgtgtggacctgggggcgc
agggatgcgtattttcttagtcctgtgtgtaccttctttctttatatcacaccttcaagt
ttctcgtggttcgtcagagatgtctccatagcttcacctcccagcaggaaccatctatag
EXON 2  113 bp
cctttttatcacttggtgagagtttgggtatcagcttacatcagaggttgtgaggaaaat
aaaaaggtatagtttgctggtaaaaaagagagtaaaactttgctaaaactcttaggttaa
caatctcatagataattgagggttgtactttgacttctgatttattcttctttgctttag
TGGTTTTCCCGGATTGTGTGTAGGTGTGAGATCAACCATGAGTTCCGTTGCAGTTTTGAC
CCAAGAGAGTTTTGCTGAACACCGAAGTGGGCTGGTTCCGCAACAAATCAAAG
gtgacagcccttttatgtgctcttcctggtaatgtctaaggcattgctccctctaaagcc
tttaccaaatcccatgccctttctagaagtaccttttggccctgtggttgtggggcaggg
agggtccaacatcttgtgcactgttttcgcattgctgtgcgtgcaggggcgactggccag
EXON 3  158 bp
ctggtgacctcctggggccttttcctatcactatgaattagaagagaggggtggggggag
ttgtccttggagcatttgatggttcttgtttgtctgtttttaagcactaaaacccttaaa
agtgtttttcatgtaatgctaaaagtagtgcttccttttaatctgtgttggctggtccag
TTGCCACTCTAAATTCAGAAGAGGAGAGCGACCCTCCAACCTACAAGGATGCCTTCCCTC
CACTTCCTGAGAAAGCTGCTTGCCTGGAAAGTGCCCAGGAACCCTCTGGAGCCTGGGGGA
ACAAGATCCGACCCATCAAGGCTTCTGTCATCACTCAG
gtagaaacaccattctttcttttaaaaattttatcatgtaacatgtctatgtaaattttt
aaattttttttcttttttttttttttgagacagagtcccgctctgtcgcccaggctggag
tgcagtggtgcgatctcggctcactgcacgctccgcctcccgggttcacgccattctcct
EXON 4  216 bp
cttgaccttggccctttctccttgtctttcggctgctttatcccagggcttcgagcagtg
cctgtgggcagggtggggctgctttgtgagtggatggtgatgaacacatgttctttactc
cctatctgttggccttcttttaatctcttaacctttccttttttgatcttttttgagcag
GTGTTCCATGTACCCCTGGAGGAGAGAAAATACAAGGATATGAACCAGTTTGGAGAAGGT
GAACAAGCAAAAATCTGCCTTGAGATCATGCAGAGAACTGGTGCTCACTTGGAGCTGTCT
TTGGCCAAAGACCAAGGCCTCTCCATCATGGTGTCAGGAAAGCTGGATGCTGTCATGAAA
GCTCGGAAGGACATTGTTGCTAGACTGCAGACTCAG
gtgggtagcctgaggcctacttctccccagtgactgtgtacccgttccattacccggctc
ctgatgcaggctagaacgtcactggacccttcctaccagtgggacagttccgtcttttgg
aggtaggacagcaacattcagagtcctctggcatttttagtggaaaaactcactaaacta
EXON 5  207 bp
ggagtcagggcaaccttccccaagcatgtgatgtttaagctcatgctgttttaatggatg
agttggtgctgctgggcaggaataagcaaagatggtgtttctgccagaatgtcttggaaa
aatatgctccttcagaacctacaaatattcttgttttcttttattctcttcttgctatag
GCCTCAGCAACTGTTGCCATTCCCAAAGAACACCATCGCTTTGTTATTGGCAAAAATGGA
GAGAAACTGCAAGACTTGGAGCTAAAAACTGCAACCAAAATCCAGATCCCACGCCCAGAT
GACCCCAGCAATCAGATCAAGATCACTGGCACCAAAGAGGGCATCGAGAAAGCTCGCCAT
GAAGTCTTACTCATCTCTGCCGAGCAG
gtgaggcctgtgtgagtgcctcgtgcccctgcctacctgcttgtgcagacctcactccct
catgggttgccgtgtccagtgtggacttcaaggcataatgtggtgggggtggagggcttg
actccaactctaaaaagccctgtctgtccccagtttgttttcaaaggcctgttctcatca
EXON 6  216 bp
tcgtgcccctgcctacctgcttgtgcagacctcactccctcatgggttgccgtgtccagt
gtggacttcaaggcataatgtggtgggggtggagggcttgactccaactctaaaaagccc
tgtctgtccccagtttgttttcaaaggcctgttctcatcagatcatcccttcctttccag
GACAAACGTGCTGTGGAGAGGCTAGAAGTAGAAAAGGCATTCCACCCCTTCATCGCTGGG
CCGTATAATAGACTGGTTGGCGAGATCATGCAGGAGACAGGCACGCGCATCAACATCCCC
CCACCCAGCGTGAACCGGACAGAGATTGTCTTCACTGGAGAGAAGGAACAGTTGGCTCAG
GCTGTGGCTCGCATCAAGAAGATTTATGAGGAGAAG
gtacacgatttagaggaggcaaatccccatgggcaggaatagaaatgaggatttgggtct
ggagattcagttaaggcctggttctgccccttatctttttgtccttgatgaagatgctta
ttgtctctacacttgagtgacccgggtgagatcggtgcccgcccccccttgctgttgagc
EXON 7  207 bp
cagtccttgaacagtgaagtttctggggattggctagtcctgatcacttgttgttcactt
cttgggatcagcatctatagtctgggccgctttggcttgctttctgcagcagtggccatg
cccacctgcccgcttcccacacctttccctttgactgccccttatggtgctcttatttag
AAAAAGAAGACTACAACCATTGCAGTGGAAGTGAAGAAATCCCAACACAAGTATGTCATT
GGGCCCAAGGGCAATTCATTGCAGGAGATCCTTGAGAGAACTGGAGTTTCCGTTGAGATC
CCACCCTCAGACAGCATCTCTGAGACTGTAATACTTCGAGGCGAACCTGAAAAGTTAGGT
CAGGCGTTGACTGAAGTCTATGCCAAG
gtaactgcctccgagcatgaagtgtgtctcctttgagtggagtccgcggggccttcatgg
atgagctctcgatttgtaaatcctggggcctggacacagtgcaggtgcccaggtttgggg
agagcgtgcctctgagccccaggtgagcagcctggctttcactgtgacacgaccttgagc
EXON 8  108 bp
agtggagtccgcggggccttcatggatgagctctcgatttgtaaatcctggggcctggac
acagtgcaggtgcccaggtttggggagagcgtgcctctgagccccaggtgagcagcctgg
ctttcactgtgacacgaccttgagctctgcaaacccatggctgttctcccattttcttag
GCCAATAGCTTCACCGTCTCCTCTGTCGCCGCCCCTTCCTGGCTTCACCGTTTCATCATT
GGCAAGAAAGGGCAGAACCTGGCCAAAATCACTCAGCAGATGCCAAAG
gtaaggacacgtttttcacctgttgtattgaatttgtcttgttttctgtctttctgtttc
tgatattgctttgttgacctttgtactgtggatgcccttgaaaactggtgtatttttctg
aattaactggcctgtttgacatggtcaacttccgtgttagcttaaagaacagcagaataa
EXON 9  105 bp
tggctccctaaccctccctttcaactttgtttgatggctgtggatatgtccctccctccc
tcacatctatgtgaagcagtttgggatcagaagccgctccgaagagagctcccactggga
gctcaggggctgcagctgtgccattctgttttagctatctctttggttttggtgtggtag
GTTCACATCGAGTTCACAGAGGGCGAAGACAAGATCACCCTGGAGGGCCCTACAGAGGAT
GTCAATGTGGCCCAGGAACAGATAGAAGGCATGGTCAAAGATTTG
gtaaggtaccccttggaatgttgtgtgtgctggtgacaagggaggctctgagttgggcat
gggcggtcatctctcgatgacatcccacatgtccgggcacagacacccagggcatcctag
ctgggtgagtaataggttctgaaacaaccagaagctggtcgaagtcctggaataatcgtg
EXON 10  79 bp
gtgggtggaggaaacttcatcttgaagaaggcatctttcaggggagatgcaggggcagtc
tccaacaattcctgacagctgagtggtcagaaaaggcaaccgtggagactgctgggtttt
ggttcagctcattggccaagtaaccaggcgcatccatggacctctgtgctcctcctgcag
ATTAACCGGATGGACTATGTGGAGATCAACATCGACCACAAGTTCCACAGGCACCTCATT
GGGAAGAGCGGTGCCAACA
gtgagtgaggctgtctgttgcggtggggccagtgtgccctgagacccttgtggggggtgt
cagctgtgagaactgtgacgtccgtgcagacagtccaggcccattgctgcctgtaatggg
agttacagactttacatcctcctgcctgctggaagaggccacttttccttttccctttgg
EXON 11  140 bp
atcataactggcccccattctagacaatggagatttttgtttgggaagctaagcatcgtt
tttggtgatgggaatcacagataaggttatttagcgctttagcgctgtcctgcccagtta
tgtcattggcagaatgttgttggtctgtgtcctaaatgtgtttccttttgtgttcctaag
TAAACAGAATCAAAGACCAGTACAAGGTGTCCGTGCGCATCCCTCCTGACAGTGAGAAGA
GCAATTTGATCCGCATCGAGGGGGACCCACAGGGCGTGCAGCAGGCCAAGCGAGAGCTGC
TGGAGCTTGCATCTCGCATG
gtaagtgccatggctgggccctctagaaaggcactggccttgcgtctcttggccccctct
aaggagtagcgtgttgtggtgtgcggccttagagaatggaagtcgacaaatcccacgttg
cactggaaccggattggactccctggggccacatttcctttatcctccccaggtcacctg
EXON 12  105 bp
atgcgctgtgcacactcttaacagctggttgctcccggggtgctacgaggtgccacctgg
agaccacctcacctgctccatgaaggactgtgcccagggctccctggtgtccccttgtgt
cagtggggagttgctcgccgtgcttgtgataaatgacatctactttaattgtatttttag
GAAAATGAGCGTACCAAGGATCTAATCATTGAGCAAAGATTTCATCGCACAATCATTGGG
CAGAAGGGTGAACGGATCCGTGAAATTCGTGACAAATTCCCAGAG
gtaaagtttcccagagacattctgtaactctataggagtgatccaagtcacacttcagga
atatttgatatttgggatatatgtccttcctcatacttgaacttagtctccccatgattt
gttctaggtcatcattaactttccagacccagcacaaaaaagtgacattgtccagctcag
EXON 13  114 bp
tcattgggcagaagggtgaacggatccgtgaaattcgtgacaaattcccagaggtaaagt
ttcccagagacattctgtaactctataggagtgatccaagtcacacttcaggaatatttg
atatttgggatatatgtccttcctcatacttgaacttagtctccccatgatttgttctag
GTCATCATTAACTTTCCAGACCCAGCACAAAAAAGTGACATTGTCCAGCTCAGAGGACCT
AAGAATGAGGTGGAAAAATGCACAAAATACATGCAGAAGATGGTGGCAGATCTG
gtaggggtgtttcacatcctttcttgtatgacagcacctggggtgggtggggcatgcgtc
ctgtcagaagtcctgacccccacaggacccctgctctggggaaagcacataggccctggg
ctggccttccatctcagggacttgggacaaagtggtgacggcttctcacttaatacctgg
EXON 14  87 bp
caacgtaagttagttgttggacaaatgatctatctcacttaccctcatgacaaacctctg
aaggtttgtttgcaaataccagtgctctgtcgtgttcatgctacccttaggggtagaagg
gatactgtattttactctctagcacaggtggtgaatcgggctgtgttttttgtctttaag
GTGGAAAATAGCTATTCAATTTCTGTTCCGATCTTCAAACAGTTTCACAAGAATATCATT
GGGAAAGGAGGCGCAAACATTAAAAAG
gtgataacttgtccgctgcatcttgcttcttcttgccttgtcctctgtagccctgcacca
ttttggttttagactaggagggactcttccttacttctagccctgtgctcaactgtgtct
caactctgggagagctctagtcagcttctcatggtgatctctctccctgtagattcgtga
EXON 15  132 bp
ttaaaaaggtgataacttgtccgctgcatcttgcttcttcttgccttgtcctctgtagcc
ctgcaccattttggttttagactaggagggactcttccttacttctagccctgtgctcaa
ctgtgtctcaactctgggagagctctagtcagcttctcatggtgatctctctccctgtag
ATTCGTGAAGAAAGCAACACCAAAATCGACCTTCCAGCAGAGAATAGCAATTCAGAGACC
ATTATCATCACAGGCAAGCGAGCCAACTGCGAAGCTGCCCGGAGCAGGATTCTGTCTATT
CAGAAAGACCTG
gtaatgggagatgttttctaatggagatcctccagtaaaatctctaacagcctctaagat
tgagcctggggttgagtcacgcagggtcattgggccagcgcaggctgatgtggaagattg
cacctttcaatccaggctactgatgagttggtcagcagttttctgcctttgtctctcacg
EXON 16  219 bp
ctctcctcccccgtgcaggtcaaaaatggcttggagaagtttggtcagtgcttgtaagtg
gcatctccagggctctaggcctgcgtgttcatcaccaccaaagatgatagtttatctttt
cctctgccctttttgccacaaaaatgtgacttcctcctcctgccctgtgtttggtttcag
GCCAACATAGCCGAGGTAGAGGTCTCCATCCCTGCCAAGCTGCACAACTCCCTCATTGGC
ACCAAGGGCCGTCTGATCCGCTCCATCATGGAGGAGTGCGGCGGGGTCCACATTCACTTT
CCCGTGGAAGGTTCAGGAAGCGACACCGTTGTTATCAGGGGCCCTTCCTCGGATGTGGAG
AAGGCCAAGAAGCAGCTCCTGCATCTGGCGGAGGAGAAG
gtgagcatggggagggagcgtgactcttggcaggaagcctggtcctcagtacagtgttct
cgcttctcactgtggaaacccctgaatgcccttcctttgtggcgggtcagaaaacagctc
tataatgtactgtttatgcgtctttgtttttgctgttactggagggcctttccaggtcca
EXON 17  222 bp
tattcatctgtttattcagtgaggtgtgctagccccattttgggggtattggtgcaacat
caggacactggtgacaatgtaaggggagcccgagcttgctgtcctacagaccctcttgtc
ttcctcactgtggtccaggcacgtggtgtcaggctaacacagtgggattggtttctgcag
CAAACCAAGAGTTTCACTGTTGACATCCGCGCCAAGCCAGAATACCACAAATTCCTCATC
GGCAAGGGGGGCGGCAAAATTCGCAAGGTGCGCGACAGCACTGGAGCACGTGTCATCTTC
CCTGCGGCTGAGGACAAGGACCAGGACCTGATCACCATCATTGGAAAGGAGGACGCCGTC
CGAGAGGCACAGAAGGAGCTGGAGGCCTTGATCCAAAACCTG
gtagggagcgggcctcggcggccgactctgctggggccgtgatggggtggcttatcttcc
atctcttcttaacactgcaggataatgtggtggaagactccatgctggtggaccccaagc
accaccgccacttcgtcatccgcagaggccaggtcttgcgggagattgctgaagagtatg
EXON 18  219 bp
tgcggctgaggacaaggaccaggacctgatcaccatcattggaaaggaggacgccgtccg
agaggcacagaaggagctggaggccttgatccaaaacctggtagggagcgggcctcggcg
gccgactctgctggggccgtgatggggtggcttatcttccatctcttcttaacactgcag
GATAATGTGGTGGAAGACTCCATGCTGGTGGACCCCAAGCACCACCGCCACTTCGTCATC
CGCAGAGGCCAGGTCTTGCGGGAGATTGCTGAAGAGTATGGCGGGGTGATGGTCAGCTTC
CCACGCTCTGGCACACAGAGCGACAAAGTCACCCTCAAGGGCGCCAAGGACTGTGTGGAG
GCAGCCAAGAAACGCATTCAGGAGATCATTGAGGACCTG
gtaggcacttgggtgctcggggaggggttctcaccccccagtggccactcaccgaagccg
tgtatgagtgttcgctccaccctgtagggaggtgactccctcatacagccctggaaggct
tcagaaggggctttctggtgctcgctcttctttcctcagcctgtctggcctccttcctga
EXON 19  139 bp
gacctgtcctgctacctccctcctccctgcgcctggagccctggactcgggagaagggga
gcatctgtgccaagtggctgtagaggacagggaggaaggtggtgtgaagagtgctgtaaa
acttgccctaaggaatttaatctttgctcttttcttttttctttgtgtacctccctccag
GAAGCTCAGGTGACATTAGAATGTGCTATACCCCAGAAATTCCATCGATCTGTCATGGGC
CCCAAAGGTTCCAGAATCCAGCAGATTACTCGGGATTTCAGTGTTCAAATTAAATTCCCA
GACAGAGAGGAGAACGCAG
gtgggtcccccattagccctgctctgcttgttaatagtggcgcctcccatgtgagaggcg
gggctgtcgcacatactggtgaggctctttcctgtctctgctggaaaaccatctatgtat
tctgggggcttccagaggttcagggtcactccctggcctttaaaagatggaccacgtcag
EXON 20  155 bp
tgtggggacgtcctatctgctctccctgaccagaccaagacctcctgaaggacaggagtg
gttttccctcccttttaccacccagcacccagcaggtgcctcacagacatatgcattctg
aacaaggtgtggggtctcttccagcagctgtcagctgtcccttttcccctttctctctag
TTCACAGTACAGAGCCAGTTGTCCAGGAGAATGGGGACGAAGCTGGGGAGGGGAGAGAGG
CTAAAGATTGTGACCCCGGCTCTCCAAGGAGGTGTGACATCATCATCATCTCTGGCCGGA
AAGAAAAGTGTGAGGCTGCCAAGGAAGCTCTGGAG
gtatgtgtccatgtgcccccctccaccccccgccaaggcccagtcagcaggcacctgggg
agacgcgtggcctggatgggatggacggttgcccaagcggcagtggcagtggaggtagcc
ctcttgctcctaccgtgtgcgcacgggctgtgcttctcggctggacacagagtttgggga
EXON 21  105 bp
atgcaaatcttttcctattcttttctattgagttaaaggtcctggtggcattgtcgggtg
gggcacattgctgttgtcatagggctgtttgccttgtgtttcgtggagccccattgctga
gcttacaacgtcactctgctctcagctcccacggcctaaccatgaccatcctccctgcag
GCATTGGTTCCTGTCACCATTGAAGTAGAGGTGCCCTTTGACCTTCACCGTTACGTTATT
GGGCAGAAAGGAAGTGGGATCCGCAAGATGATGGATGAGTTTGAG
gtagacccctttcccgggaggccatgtcacaggagtggcctgtcgcatcctctcccgagt
gccagtgtcctttctcaacttcctgttgactctgcctcctcctgctcggactgggcactg
acttcccttcacggcgggtggccttccctctcaccacttctgggtcccagggccaatgga
EXON 22  135 bp
ccgagtgccagtgtcctttctcaacttcctgttgactctgcctcctcctgctcggactgg
gcactgacttcccttcacggcgggtggccttccctctcaccacttctgggtcccagggcc
aatggactctttcctgttctctggggtcctgaacgtcaagtcagccccctcttcacgtag
GTGAACATACATGTCCCGGCACCTGAGCTGCAGTCTGACATCATCGCCATCACGGGCCTC
GCTGCAAATTTGGACCGGGCCAAGGCTGGACTGCTGGAGCGTGTGAAGGAGCTACAGGCC
GAGCAGGAGGACCGG
gtgagcaggaggtggccggggcactgcccagagccatggtgctcagctttgggcacatgt
cagaatctagggaagttcttcaggatcccagcatcccagcgacatctggctggaggtgag
atgcaggcagtgccaggacgcagtcagcatccaggggtcttgctgtggaactagccaaga
EXON 23  144 bp
attattagcagataatggaaggtggcagaggtcggaccagagagatggcggaccattccg
gaccacgggttacagaacactgcagcatctccagtgtcctatgaccagggtggaagggga
atggagtcacagggtggatcagctcaatctttgcctcattcttgctcctttcatttgtag
GCTTTAAGGAGTTTTAAGCTGAGTGTCACTGTAGACCCCAAATACCATCCCAAGATTATC
GGGAGAAAGGGGGCAGTAATTACCCAAATCCGGTTGGAGCATGACGTGAACATCCAGTTT
CCTGATAAGGACGATGGGAACCAG
gtgagagcctcggttggagcgtgtcgggggcagaggtgcttgttgacctttcctgtgact
tgggagcagtaaccagatgtgcctagatgggggttcgagggccaagttgagagtggcaag
tctctcaggacctaattctggcttgaggtttgggctgtgtctcggtacttgccagatggg
EXON 24  186 bp
gcgtgagccaccgtgcccggccctgagtggacattgttaacctcttgttttaaatcagcc
gtgacgttgctttccatcttctctcctgagctgttttcctcagcagtgggggccggctct
tgcccctgacgggaatcccagtaaggcatccccttttctgactacattctccttttttag
CCCCAGGACCAAATTACCATCACAGGGTACGAAAAGAACACAGAAGCTGCCAGGGATGCT
ATACTGAGAATTGTGGGTGAACTTGAGCAGATGGTTTCTGAGGACGTCCCGCTGGACCAC
CGCGTTCACGCCCGCATCATTGGTGCCCGCGGCAAAGCCATTCGCAAAATCATGGACGAA
TTCAAG
gtgagccggctggaagcacagtgggtgagaatcctctctcaccgggggcacctggctggc
cagaagaaagagcagggcatggccttcccctcaagatgatgaggccacaaccccagggct
ggcagtggaactgtcctcatggacaccacgggtcagtgcaggcgacggcctgtgtgaggc
EXON 25  117 bp
gtgctcctgagatacacctaacttggtgtggtgatgaggctgactgacttcagaacaact
ctgaaaccagattttaaaacgtttgctaactcagaaaatgcttcactagaaattgacaca
taattttaacccttttcctcgcttggagtcccctcatctgacgttgtacaccccttccag
GTGGACATTCGCTTCCCACAGAGCGGAGCCCCAGACCCCAACTGCGTCACTGTGACGGGG
CTCCCAGAGAATGTGGAGGAAGCCATCGACCACATCCTCAATCTGGAGGAGGAATAC
gtgagtctctgtgggccttggagccctgaggcgccctggcacgtccaccggcctgaggcc
cagccaggagcttcaggggacaaggtggcacttgtgtttccagaggcaggcgaggtgcag
gggtgagcaggcgggcgggatgctgggggtgctgggcagactgaccctgtcttcctgtct
EXON 26  129 bp
tgggccttggagccctgaggcgccctggcacgtccaccggcctgaggcccagccaggagc
ttcaggggacaaggtggcacttgtgtttccagaggcaggcgaggtgcaggggtgagcagg
cgggcgggatgctgggggtgctgggcagactgaccctgtcttcctgtcttctgcctgcag
CTAGCTGACGTGGTGGACAGTGAGGCGCTGCAGGTATACATGAAACCCCCAGCACACGAA
GAGGCCAAGGCACCTTCCAGAGGCTTTGTGGTGCGGGACGCACCCTGGACCGCCAGCAGC
AGTGAGAAG
gtcagatgcgggcttctgccctcctgggtcccagggagggtgggcgggcaggcgggcttg
gtgtcctgagggtggcaactgcgtcggaagctgcttgcgagttggggagcatcccctcct
gaagccgtgtcctctctctgcacaggctcctgacatgagcagctctgaggaatttcccag
EXON 27  473 bp
gggacgcaccctggaccgccagcagcagtgagaaggtcagatgcgggcttctgccctcct
gggtcccagggagggtgggcgggcaggcgggcttggtgtcctgagggtggcaactgcgtc
ggaagctgcttgcgagttggggagcatcccctcctgaagccgtgtcctctctctgcacag
GCTCCTGACATGAGCAGCTCTGAGGAATTTCCCAGCTTTGGGGCTCAGGTGGCTCCCAAG
ACCCTCCCTTGGGGCCCCAAACGATAATGATCAAAAAGAACAGAACCCTCTCCAGCCTGC
TGACCCAAACCCAACCACACAATGGTTTGTCTCAATCTGACCCAGCGGCTGGACCCTCCG
TAAATTGTTGACGCTCTTCCCCCTTCCCGAGGTCCCGCAGGGAGCCTAGCGCCTGGCTGT
GTGTGCGGCCGCTCCTCCAGGCCTGGCCGTGCCCGCTCAGGACCTGCTCCACTGTTTAAC
ACTAAACCAAGGTCATGAGCATTCGTGCTAAGATAACAGACTCCAGCTCCTGGTCCACCC
GGCATGTCAGTCAGCACTCTGGCCTTCATCACGAGAGCTCCGCAGCCGTGGCTAGGATTC
CACTTCCTGTGTCATGACCTCAGGAAATAAACGTCCTTGACTTTATAAAAGCC
aaacgtttgccctcttcctttcccacctccctcctgccagtttcccttggtccagacagt
cctgtttgtggagtgcaatcagcctcctccagctgccagagcgcctcagcacaggtgtca
gggtgcaaggaagacctggcaatggacagcaggaggcaggttcctggagctggggggtga