Gene HDAC4 Variant 1
DNA : 352.26 KbNT_022173
mRNA : 8458 bp NM_006037
CDS : 3255 bp NP_006028
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  573 bp
ggcccgcaaggggaggtgacgcaaggctgccgcagccaatggttggcgagccgccggctg
gctgggcggggccgggccggctgacgggcgtgcggggtggcctatcgccgcctggctcga
cgctggagtggggagaagcatcatggttcaacgtgggtcaattttttgtgaatgaggagg
GGAGGTTGTGGGGCCGCCGCCGCGGAGCACCGTCCCCGCCGCCGCCCGAGCCCGAGCCCG
AGCCCGCGCACCCGCCCGCGCCGCCGCCGCCGCCGCCCGAACAGCCTCCCAGCCTGGGCC
CCCGGCGGCGCCGTGGCCGCGTCCCGGCTGTCGCCGCCCGAGCCCGAGCCCGCGCGCCGG
CGGGTGGCGGCGCAGGCTGAGGAGATGCGGCGCGGAGCGCCGGAGCAGGGCTAGAGCCGG
CCGCCGCCGCCCGCCGCGGTAAGCGCAGCCCCGGCCCGGCGCCCGCGGGCCATTGTCCGC
CGCCCGCCCCGCGCCCCGCGCAGCCTGCAGGCCTTGGAGCCCGCGGCAGGTGGACGCCGC
CGGTCCACACCCGCCCCGCGCGCGGCCGTGGGAGGCGGGGGCCAGCGCTGGCCGCGCGCC
GTGGGACCCGCCGGTCCCCAGGGCCGCCCGGCCCCTTCTGGACCTTTCCACCCGCGCCGC
GAGGCGGCTTCGCCCGCCGGGGCGGGGGCGCGGGGGTGGGCACGGCAGGCAGCGGCGCCG
TCTCCCGGTGCGGGGCCCGCGCCCCCCGAGCAG
gtgggctccgggccgccgggagtgagggcgggggcgggcgggcgccggggccggccgggc
gccgtttatgtaactttgtcaaatgctgtgagtttgcagaaaaacgtccctgccgggggt
ccgcggccccgcgcttgtcgtcgccgctgcgagcgcccggggggtcgcgggagggcgggg
EXON 2  241 bp
aggggtggtggaggttgcagtgagcccagatcgtgccaccacactccagcctgggcgata
gagcaagattctgtctccaaaaaaaaagaggaagtcatcatttccctagttggatgttgt
tttccagatcggaacttccatgttgtaactccagtctcttttctccttctgaccttgcag
GTTCATCTGCAGAAGCCAGCGGACGCCTCTGTTCAACTTGTGGGTTACCTGGCTCATGAG
ACCTTGCCGGCGAGGCTCGGCGCTTGAACGTCTGTGACCCAGCCCTCACCGTCCCGGTAC
TTGTATGTGTTGGTGGGAGTTTGGAGCTCGTTGGAGCTATCGTTTCCGTGGAAATTTTGA
GCCATTTCGAATCACTTAAAGGAGTGGACATTGCTAGCAATGAGCTCCCAAAGCCATCCA
G
gtaaggccgggtcatttcttctctgggcacacagcggggctttctttgcccaaagtagaa
gttcttgtgactgcagcttgctttctggatttgagacttttgtttttcttgatagtggtc
actgttggtttttgacagcacaaagtgcaaaatggatggtttattcttcctcttggtgaa
EXON 3  72 bp
attattctacattggcaaatacaaataatctatgatgaagctgaaagtgtccccctgtaa
aagtaggaaggacacatgcatttcattgtttggggagttactccctgcagactcccagca
taaagtatgttggctgaaatgcgcgcagtttctgaagccagtgccttctctgttctccag
ATGGACTTTCTGGCCGAGACCAGCCAGTGGAGCTGCTGAATCCTGCCCGCGTGAACCACA
TGCCCAGCACGG
gtaagtccgcccacccctgccctgtccggccggccctgcgctgagccaaagaggtgttca
gacgctctgccttattggaggagtgcagagagggcgaggggggaggtgtggggtatcagg
ttcactgaatttgggtgctcttcctggtggtaaaagaggccatcctttttggaaatgaaa
EXON 4  245 bp
gtcttgcattttgagtttgttgggcaagagggggacagggggagaggggtatccaatcct
caaatggtcacaaccccccccccgccccgtgaaggtggccagtgtgttgggtgggggctc
tggggcccagggacagcaaagggcggcagtgaccggctctcctgcttgtttttcccacag
TGGATGTGGCCACGGCGCTGCCTCTGCAAGTGGCCCCCTCGGCAGTGCCCATGGACCTGC
GCCTGGACCACCAGTTCTCACTGCCTGTGGCAGAGCCGGCCCTGCGGGAGCAGCAGCTGC
AGCAGGAGCTCCTGGCGCTCAAGCAGAAGCAGCAGATCCAGAGGCAGATCCTCATCGCTG
AGTTCCAGAGGCAGCACGAGCAGCTCTCCCGGCAGCACGAGGCGCAGCTCCACGAGCACA
TCAAG
gtgaggcgcggtgcggggctgcgggtgggccaggcctccggcaccctcaactcccggtga
ctccagccctgcctccgcggagtgtgctggggccccaggcatgatgcagggttcctgcag
gaggccttctgcgttgggacggtaacaccaggcaacaaaccgcgggcagcacttgcgtgt
EXON 5  151 bp
ccggaatggccctgacttctttttttggactgaaatagcagcagtgcagggcagggcagt
gcccagggccacaccagggcagacgtgtagggcctgggctggtttcttgggtcttcattg
ggtctctgtgtgtgtgtggagcctgggctctgaccgtctgtctcctccttccacttgcag
CAACAACAGGAGATGCTGGCCATGAAGCACCAGCAGGAGCTGCTGGAACACCAGCGGAAG
CTGGAGAGGCACCGCCAGGAGCAGGAGCTGGAGAAGCAGCACCGGGAGCAGAAGCTGCAG
CAGCTCAAGAACAAGGAGAAGGGCAAAGAGA
gtgagtgtgggcacggaaggccaggcagagggagggaggccgggcagagggaggggtgcg
ggcacggaaggctgggcagagggagggagtgcgggcgcagaaggccgggcagagggaggg
aggccgggcagagggagggaggccgggcagagggaggggtgcgggcacggaaggctgggc
EXON 6  121 bp
aacctctcattaaaacccctcccggccttggttctttgaggaagcgctcaggaggccaca
gcgtcctgaaggtgcatagccgtccccagcccttccctccctctgtggccccgctgccct
gcattgctgctgtagggcagagccacacttcaccccctgctatgctttctcccacgccag
GTGCCGTGGCCAGCACAGAAGTGAAGATGAAGTTACAAGAATTTGTCCTCAATAAAAAGA
AGGCGCTGGCCCACCGGAATCTGAACCACTGCATTTCCAGCGACCCTCGCTACTGGTACG
G
gtaagtgtgggtgtggggagcaccccggcctcctctctgggggcccagaggactgtctga
tcgccggtagatttgcatggagccagctcttcaccggaggcagggaaggagggtgaggaa
ttgaaaccccaagcacagtggtgctcggatgtgggtgacgtgttctgggggtacactcgt
EXON 7  122 bp
gcttgtttagcatcctgtttgtttccatttaatttcagcttgaccctagggaaaaggtgt
gtctgttgaggtggggctgaggtttcaagggaaagatcatcgtgtgtggcttctcggctg
cagcatgcctggggcagtgcgctgggtaaactaaaccatctgtctttgccttctctccag
GAAAACGCAGCACAGTTCCCTTGACCAGAGTTCTCCACCCCAGAGCGGAGTGTCGACCTC
CTATAACCACCCGGTCCTGGGAATGTACGACGCCAAAGATGACTTCCCTCTTAGGAAAAC
AG
gtcagtgcccaggcatgctgtgggccgggaggtctcctgcacgggcaccttccacgccac
aagccacgcagggcccaccgctgtcttccacttagagaaggaatcacctgcagattttta
aatattttctcctttcatagagcatcgtttttaaaagatatccctaaacatttccttatt
EXON 8  132 bp
ctgatgaatgggatttagaatcccctgcttcgtgagctccctgcgctctcccctgcagca
acacagcagtgttgagcaaatatttactcaccagagtgcgtatttttaaaaaaccaccaa
caggataaccttgagccagtggtgtctgcctggctgtaatgacatctcctttttgtgcag
CTTCTGAACCGAATCTGAAATTACGGTCCAGGCTAAAGCAGAAAGTGGCCGAAAGACGGA
GCAGCCCCCTGTTACGCAGGAAAGACGGGCCAGTGGTCACTGCTCTAAAAAAGCGTCCGT
TGGATGTCACAG
gtatgtcggctgagcaggtacacccgccccgctgccctctctgccaggccttcctgccat
aggcgatttctctcaggagcttctgaaaacccacgtgtctgcctcacgctgtcaaccccc
agtgtggtcctgttcccatggcgctggaagtgccaggcccaggggaccaggtttgatgac
EXON 9  113 bp
tcagaaatcagcatcatactttcttttttgaaaccatggccatgttctttttgttgggac
ttctgcctgtcgcaagctaacgagcaggtccgtggaaggcaccgggcattcgggccacag
gtcagcacggccctccctccgcatggagtaacactcaccagggtatttctgcctccgcag
ACTCCGCGTGCAGCAGCGCCCCAGGCTCCGGACCCAGCTCACCCAACAACAGCTCCGGGA
GCGTCAGCGCGGAGAACGGTATCGCGCCCGCCGTCCCCAGCATCCCGGCGGAG
gtcagtgcgaagcgtttgtcctgtgtcctacggctagagtcggactcgggacggatgagc
ttgaaatgaccccactttgcacttgcccttcactcttcaccttccaatttggggtgaggg
aaagtggcctgtgagccatcctaaaaaggacgcagttggaggttactctcctgccttcct
EXON 10  117 bp
tttcatgttgtggcacgtgttgaaatctcatgctctcattgctgtctcatttgttacatg
tacgtttacgctcatatatcagaattcagtgcaggtgttttcatcgttgtttttcttggt
gtatattgctgatgtttggccgtgacagactgtgatggtcatcgtgtgttctgtccccag
ACGAGTTTGGCGCACAGACTTGTGGCACGAGAAGGCTCGGCCGCTCCACTTCCCCTCTAC
ACATCGCCATCCTTGCCCAACATCACGCTGGGCCTGCCTGCCACCGGCCCCTCTGCG
gtaagtcagcccccgtgggtccgtgtggtgtggggtggtggtgatgggtccttccacccg
agcatcctggctgtgctttccagggcacggcgggccagcaggacgccgagagactcaccc
ttcccgccctccagcagaggctctcccttttccccggcacccacctcactccctacctga
EXON 11  199 bp
tgtggcacgagaaggctcggccgctccacttcccctctacacatcgccatccttgcccaa
catcacgctgggcctgcctgccaccggcccctctgcggtaagtcagcccccgtgggtccg
tgtggtgtggggtggtggtgatgggtccttccacccgagcatcctggctgtgctttccag
GGCACGGCGGGCCAGCAGGACGCCGAGAGACTCACCCTTCCCGCCCTCCAGCAGAGGCTC
TCCCTTTTCCCCGGCACCCACCTCACTCCCTACCTGAGCACCTCGCCCTTGGAGCGGGAC
GGAGGGGCAGCGCACAGCCCTCTTCTGCAGCACATGGTCTTACTGGAGCAGCCGCCGGCA
CAAGCACCCCTCGTCACAG
gtgagcacaaatgggcctgggtgcagccaggctctgaggctgcccacgctctggatggtg
ccccgccttcgcctgcctttggaggagacaggaatgcacgcctgtcccacccccacagtt
cccaaacacacatccccatcacgtgatgtagccaccgtgactgcagtgaaaatccatgcc
EXON 12  224 bp
agctggaaggggcccagttagcgagccagctctggggcaccagggcagaacgcctgggct
ggcgggcacagggcgcagttgtctccatcacttactcaatagccctctctccctcctctc
ttcttcctcttcccctctgctgtttcttcctccaattatcttcagactggtatctttcag
GCCTGGGAGCACTGCCCCTCCACGCACAGTCCTTGGTTGGTGCAGACCGGGTGTCCCCCT
CCATCCACAAGCTGCGGCAGCACCGCCCACTGGGGCGGACCCAGTCGGCCCCGCTGCCCC
AGAACGCCCAGGCTCTGCAGCACCTGGTCATCCAGCAGCAGCATCAGCAGTTTCTGGAGA
AACACAAGCAGCAGTTCCAGCAGCAGCAACTGCAGATGAACAAG
gtgggtttgccggctcagcgctcccaggccccagggcggctgtgtgctgtgcgcttcagc
ctcaggcttcagcactggcccctttctgaccttaagggaggccaggaggcagaaagaggg
aaccgaggaggcacatgctctggcccacagcacagagctgggcaggggcaggggcagaag
EXON 13  258 bp
tcaggcaccccagtgcctgttgggagataaaggtgcctgctggcctgtggcagggtgata
aggtgccctgagtccctgattgtctgccccagagggtggggtttgcagcatcccttctcc
tgtcagatgagctcagaggacccagctctctgtgcttcatgtgttacctccgccttgcag
ATCATCCCCAAGCCAAGCGAGCCAGCCCGGCAGCCGGAGAGCCACCCGGAGGAGACGGAG
GAGGAGCTCCGTGAGCACCAGGCTCTGCTGGACGAGCCCTACCTGGACCGGCTGCCGGGG
CAGAAGGAGGCGCACGCACAGGCCGGCGTGCAGGTGAAGCAGGAGCCCATTGAGAGCGAT
GAGGAAGAGGCAGAGCCCCCACGGGAGGTGGAGCCGGGCCAGCGCCAGCCCAGTGAGCAG
GAGCTGCTCTTCAGACAG
gtgaccgcaggcggggagggcaccagaaggctggcacgcacagccaccctcggtccccag
gtggcatcttctgtggtgatcacgggggctgcagggcatccttgcgcggtcactgtccag
tgtctcacctgtcttgtcctggccagtgagggaggttgatgtggcttccattttgtccca
EXON 14  187 bp
ctcaggcttcagggcactcacagggaaggcctctccacgcagctggcctcccggcatcct
tgtggcccatgtatggcctgtgcgtggacgggagacttgcaagagagggcaacccctagc
cctgcagcccaggggcgggagacatccgcaaccgccaacacggccgtttcttccccgcag
CAAGCCCTCCTGCTGGAGCAGCAGCGGATCCACCAGCTGAGGAACTACCAGGCGTCCATG
GAGGCCGCCGGCATCCCCGTGTCCTTCGGCGGCCACAGGCCTCTGTCCCGGGCGCAGTCC
TCACCCGCGTCTGCCACCTTCCCCGTGTCTGTGCAGGAGCCCCCCACCAAGCCGAGGTTC
ACGACAG
gtaacacgtggcctttgtgcagcctgagggtgcaacgcgggccacagtgggcacagcgcg
gggggctcttcccggcccagctctgcagaggctgaggaggggctgggcaggcacgagggc
cacgctggatggtggggaccacacaggtctgtcacagaggccctctccccgccctacacc
EXON 15  134 bp
tctctgggcctggccagtcaaggagtcttggcaaacgtggtatttttctaaagaaccgtc
ccagcttccgtctccttctagggaagtggtggttccgccaccacccgggggcagcctgcc
agtgggtggtcggctcgcccctggatgtgcgctgatcttggcccctctgccccgccccag
GCCTCGTGTATGACACGCTGATGCTGAAGCACCAGTGCACCTGCGGGAGTAGCAGCAGCC
ACCCCGAGCACGCCGGGAGGATCCAGAGCATCTGGTCCCGCCTGCAGGAGACGGGCCTCC
GGGGCAAATGCGAG
gtaacgccgaccggggcaggtgggcagctgcggctttgggcaccattagaggggaccctc
gtgggcccgcgtgattcagggtgttggttttgcaggtggttctttgggcttacagccccg
ggggaagggccacaagcatcttcactgtctgcatttgggcgggcagctatctgctgagaa
EXON 16  121 bp
attttaaaatatcacgttgggtgatgttgcttcttcttttgcagtaaccaaataacatgc
ttgtttttgtatcaaattaagtttccttttgggcaatggtttcagttggagtttctgtct
gtggagctgaagcagcagcttctgcagaacgtgtgagtgtcctctcgcctgtccccacag
TGCATCCGCGGACGCAAGGCCACCCTGGAGGAGCTACAGACGGTGCACTCGGAAGCCCAC
ACCCTCCTGTATGGCACGAACCCCCTCAACCGGCAGAAACTGGACAGTAAGAAACTTCTA
G
gtatttcaggaccttcctttcctcccatattgggtttgaagtcccctgaggttgtgtttc
cagctctcaaccccttgtgtctggggcacctgtgggtgtcgcctgccaggttataaggta
aagggcctgaaagggaacctttcaccctctgttcacaagccactggttgttgatgaacgt
EXON 17  47 bp
tctaagggccagacactgaccctgcagcagggccacagggtgtcacaagggggagcagtg
gcccctcgttgtcccacaaatgcccaagtgccactgaagaccccggagtgcgcccagggc
ctgtcgagcaccttggccgcgtgcccttggcctctctgaccgtctccctcccccccacag
GCTCGCTCGCCTCCGTGTTCGTCCGGCTCCCTTGCGGTGGTGTTGGG
gtaagtgttcctttaatgtgtaaataatgtcctgtttcttctcgagtcccagtggtcaca
gaaatcgcagccttgcttccctcaaagtgaataattgctgccaggtgttttccatacgca
ggggctgcccatgtgcggcttcaaaggccgtgtgagccgagagcgttttgatcgccgact
EXON 18  108 bp
aactttttggcatgtcttaaaaagattgaaggctgaacgtgggctgcagctgccctggct
ctggtaggccctggggtttcagaagcagagcccacggaacctgagctgctctgcccagcc
agggctggtgatgacggtggcctgggagggtgacctcactgtggggtgttgtttccacag
GTGGACAGTGACACCATATGGAACGAGGTGCACTCGGCGGGGGCAGCCCGCCTGGCTGTG
GGCTGCGTGGTAGAGCTGGTCTTCAAGGTGGCCACAGGGGAGCTGAAG
gtcagtcggggcctggacagtggtggccctccaggaggcctgccatagattcccagtgtg
gggaggggccgcccactccgtctccctctcatcaggctgggaggcggctgtgatggggag
gcgtggaccccactctgtcagcacagcctcgctattgaatcaaagagacattgcccacat
EXON 19  56 bp
ttcccggaaaggctcccagctggccctgcatcctgtccccatcactgtggccagggtgca
gcaagaaactgtcctcctgtgtagcccaactctgctaaaagttgagtgtgcaaccatttt
cccgtggctacaaagtgtgtcttttgttgctctctcctggctgtctggtgtcacctgcag
AATGGCTTTGCTGTGGTCCGCCCCCCTGGACACCATGCGGAGGAGAGCACGCCCAT
gtgagtacacgccgcagccccgcacagcaggggaacccaggtcttccttccctcccttag
ggctgggtgggtgtgtgagtgactgcggggagctgggctgctgtttgctggccacccagg
atgtgccgcatgccggcttggctccagctcctgggtgtggagtgcagatgccaaagtctg
EXON 20  88 bp
tgtctgtctgttaaccgattctccggcatcactgagggttccctgcgacgtattcaggag
ctctgcactcacagagacctcttaggtctgcgtggaccccgagtggctctctggcgggcc
gtggagaaactggccaccgcccacctgcgcttcgtctccagcgtcagttctctcccgcag
GGGCTTTTGCTACTTCAACTCCGTGGCCGTGGCAGCCAAGCTTCTGCAGCAGAGGTTGAG
CGTGAGCAAGATCCTCATCGTGGACTGG
gtaagcagagccgccttggccagcgcagctcaggttgctcctttgccgtccccgagcgga
cagcagcgtgtggacagaggagctgggctcttggatgtgggaagcttaggtttctggaaa
cggtctcaaagatgcggagaagtaaagccccaaacctgctacaagtcattgtacagcttc
EXON 21  120 bp
agccctgacccacacagccccagaatcgcgcctgccgggtacgggcccagctggagggta
atgtcattcctgagcaggagccgttgtcactaagcacaactggggttggggacggccctc
aggggaggccaccctccaatacctgcctcagccctgaagtagttgtccctgctctttaag
GACGTGCACCATGGAAACGGGACCCAGCAGGCTTTCTACAGCGACCCCAGCGTCCTGTAC
ATGTCCCTCCACCGCTACGACGATGGGAACTTCTTCCCAGGCAGCGGGGCTCCTGATGAG

gtaggtggggtatataagggcctctggggggaaagggggactgcggggagccgctgtggg
ggcacggggcagacggtccacagctgcccggcagcagtgagtgcggccttcgtgctcact
taagcccagacagtaacttcagtcagacgtcagcctgcatcgtatcgcgtgtgcacaggt
EXON 22  98 bp
tgtcagtggggccccttcacacgcgtcttaatgaatatgcaccaggagatcaggacacgt
gggctctccccaggggcccaccaaggccgagcccatcccggtgccacctgcatcaggcgt
tcctgtcagacaggtcccgctcggggtccatgacgtgtgtttctctccttctggccacag
GTGGGCACAGGGCCCGGCGTGGGTTTCAACGTCAACATGGCTTTCACCGGCGGCCTGGAC
CCCCCCATGGGAGACGCTGAGTACTTGGCGGCCTTCAG
gtgagcctcccggcttcacatgacacctgaagtagcagcttttcctctgtgcacacattc
caggaagcacttgttggagatgagcgtgtctgaaactggtctgtggctgaacggggctgt
ggggtccggaggagctgtctcagttcattcttcagtgccaagcgtggaatcttggcgact
EXON 23  119 bp
gattcccttctaattaagcgtggtcgccagattccagcctgctgtgtggagccctcagcc
cgccagtggccgagggggtgcggggcaggcattatcaatgccagagggaaccttggggtt
ttgtgaccgtcccgtccctctttcagctgacccagtaacgccttctcctgtcctttgcag
AACGGTGGTCATGCCGATCGCCAGCGAGTTTGCCCCGGATGTGGTGCTGGTGTCATCAGG
CTTCGATGCCGTGGAGGGCCACCCCACCCCTCTTGGGGGCTACAACCTCTCCGCCAGAT
gtaagtggttctgcatatgactgaggagccggttctgctcatgtccatgatccgctgtgt
tccgcgtgtcaggtcccctttttaataacgagataaggaagggcacctttttactaatga
ccaaggttctgaccgtactgggaaccagtccatttgggaggccccagagagcccagagca
EXON 24  134 bp
atcaaagaggaaatccaaagccgaaactcttcagcgaatttattaaacgaaacccggcct
ggccatgtgtctcgacaccccagcccccagtcttcttacgatgccatgagacgcgtttct
gggctgtgctggctgcggtcctcccccgttcacactgcagtctcccgtttcccgttgcag
GCTTCGGGTACCTGACGAAGCAGCTGATGGGCCTGGCTGGCGGCCGGATTGTCCTGGCCC
TCGAGGGAGGCCACGACCTGACCGCCATTTGCGACGCCTCGGAAGCATGTGTTTCTGCCT
TGCTGGGAAACGAG
gtaggaagaccccagagaccccacaggatgctccacactgacaggctcggggttgtggcc
tggctgcccgagagccccagagcatgaaaaagccagtgggtctctgaccacgtggatgct
tgcagctccgccttgcacctgccccccacccccgcatagctctaaatgtggcagaaccgt
EXON 25  85 bp
aaaaaaattataaataccacggcacatttggctttttaaagttatttttttctactctgt
gggcaaatgcaccccacaagggtctctgtgctcaggaaacagttgcagtctcggaacacc
cgtctaacgcacgtgtggattatattggcagtctttatattcttatgcattttcttccag
CTTGATCCTCTCCCAGAAAAGGTTTTACAGCAAAGACCCAATGCAAACGCTGTCCGTTCC
ATGGAGAAAGTCATGGAGATCCACA
gtaagttgcctggctgggtgctcacaggggacacgcccctgggggtgggactgcaccaca
ccccatccctgtccccctatacccccagctcttctccatcccactgccggctgcttcccc
aggcctgcagcagaaggccttgctttcagctgcatttcttgagctggtagagactcacat
EXON 26  142 bp
gtctttgtgagtttgtagccatgcagtcttctgcttcgtgtctcttcaaagacgggtgct
tttaaaatcataagggatcaatctggtttgaggctcagggtcccgcaggaccttcccggg
cctcagtgcatcctgctaagttgtagtcactgagcgactttcctcaccccaccaccccag
GCAAGTACTGGCGCTGCCTGCAGCGCACAACCTCCACAGCGGGGCGTTCTCTGATCGAGG
CTCAGACTTGCGAGAACGAAGAAGCCGAGACGGTCACCGCCATGGCCTCGCTGTCCGTGG
GCGTGAAGCCCGCCGAAAAGAG
gtgagcacctgccctgccgcccgcctgcaggctcacccagccccactgtgcccactgaca
cactattcagggtcagaacctttatggcacatgccctgcccaacagactagagacaggcc
agtgtggccccctccttccagtgccaaagccccttagagacgcatgaggagcattagatc
EXON 27  4451 bp
ccaaagccccttagagacgcatgaggagcattagatcctgaacagatggacccggggctg
ccaggccagggctaggctggcgggtggggcagcacacagcctttaacccacgttctgttc
tctcctctctgtggtgcacctgccccacgcccccatctccttctcttgcgggatccacag
ACCAGATGAGGAGCCCATGGAAGAGGAGCCGCCCCTGTAGCACTCCCTCGAAGCTGCTGT
TCTCTTGTCTGTCTGTCTCTGTCTTGAAGCTCAGCCAAGAAACTTTCCCGTGTCACGCCT
GCGTCCCACCGTGGGGCTCTCTTGGAGCACCCAGGGACACCCAGCGTGCAACAGCCACGG
GAAGCCTTTCTGCCGCCCAGGCCCACAGGTCTCGAGACGCACATGCACGCCTGGGCGTGG
CAGCCTCACAGGGAACACGGGACAGACGCCGGCGACGCGCAGACACACGGACACGCGGAA
GCCAAGCACACTCTGGCGGGTCCCGCAAGGGACGCCGTGGAAGAAAGGAGCCTGTGGCAA
CAGGCGGCCGAGCTGCCGAATTCAGTTGACACGAGGCACAGAAAACAAATATCAAAGATC
TAATAATACAAAACAAACTTGATTAAAACTGGTGCTTAAAGTTTATTACCCACAACTCCA
CAGTCTCTGTGTAAACCACTCGACTCATCTTGTAGCTTATTTTTTTTTAAAGAGGACGTT
TTCTACGGCTGTGGCCCGCCTCTGTGAACCATAGCGGTGTGCGGCGGGGGGTCTGCACCC
GGGTGGGGGACAGAGGGACCTTTAAAGAAAACAAAACTGGACAGAAACAGGAATGTGAGC
TGGGGGAGCTGGCTTGAGTTTCTCAAAAGCCATCGGAAGATGCGAGTTTGTGCCTTTTTT
TTTATTGCTCTGGTGGATTTTTGTGGCTGGGTTTTCTGAAGTCTGAGGAACAATGCCTTA
AGAAAAAACAAACAGCAGGAATCGGTGGGACAGTTTCCTGTGGCCAGCCGAGCCTGGCAG
TGCTGGCACCGCGAGCTGGCCTGACGCCTCAAGCACGGGCACCAGCCGTCATCTCCGGGG
CCAGGGGCTGCAGCCCGGCGGTCCCTGTTTTGCTTTATTGCTGTTTAAGAAAAATGGAGG
TAGTTCCAAAAAAGTGGCAAATCCCGTTGGAGGTTTTGAAGTCCAACAAATTTTAAACGA
ATCCAAAGTGTTCTCACACGTCACATACGATTGAGCATCTCCATCTGGTCGTGAAGCATG
TGGTAGGCACACTTGCAGTGTTACGATCGGAATGCTTTTTATTAAAAGCAAGTAGCATGA
AGTATTGCTTAAATTTTAGGTATAAATAAATATATATATGTATAATATATATTCCAATGT
ATTCCAAGCTAAGAAACTTACTTGATTCTTATGAAATCTTGATAAAATATTTATAATGCA
TTTATAGAAAAAGTATATATATATATATAAAATGAATGCAGATTGCGAAGGTCCCTGCAA
ATGGATGGCTTGTGAATTTGCTCTCAAGGTGCTTATGGAAAGGGATCCTGATTGATTGAA
ATTCATGTTTTCTCAAGCTCCAGATTGGCTAGATTTCAGATCGCCAACACATTCGCCACT
GGGCAACTACCCTACAAGTTTGTACTTTCATTTTAATTATTTTCTAACAGAACCGCTCCC
GTCTCCAAGCCTTCATGCACATATGTACCTAATGAGTTTTTATAGCAAAGAATATAAATT
TGCTGTTGATTTTTGTATGAATTTTTTCACAAAAAGATCCTGAATAAGCATTGTTTTATG
AATTTTACATTTTTCCTCACCATTTAGCAATTTTCTGAATGGTAATAATGTCTAAATCTT
TTTCCTTTCTGAATTCTTGCTTGTACATTTTTTTTTACCTTTCAAAGGTTTTTAATTATT
TTTGTTTTTATTTTTGTACGATGAGTTTTCTGCAGCGTACAGAATTGTTGCTGTCAGATT
CTATTTTCAGAAAGTGAGAGGAGGGACCGTAGGTCTTTTCGGAGTGACACCAACGATTGT
GTCTTTCCTGGTCTGTCCTAGGAGCTGTATAAAGAAGCCCAGGGGCTCTTTTTAACTTTC
AACACTAGTAGTATTACGAGGGGTGGTGTGTTTTTCCCCTCCGTGGCAAGGGCAGGGAGG
GTTGCTTAGGATGCCCGGCCACCCTGGGAGGCTTGCCAGATGCCGGGGGCAGTCAGCATT
AATGAAACTCATGTTTAAACTTCTCTGACCACATCGTCAGGATAGAATTCTAACTTGAGT
TTTCCAAAGACCTTTTGAGCATGTCAGCAATGCATGGGGCACACGTGGGGCTCTTTACCC
ACTTGGGTTTTTCCACTGCAGCCACGTGGCCAGCCCTGGATTTTGGAGCCTGTGGCTGCA
AGGAACCCAGGGACCCTTGTTGCCTGGTGAACCTGCAGGGAGGGTATGATTGCCTGACCA
GGACAGCCAGTCTTTACTCTTTTTCTCTTCAACAGTAACTGACAGTCACGTTTTACTGGT
AACTTATTTTCCAGCACATGAAGCCACCAGTTTCATTCCAAAGTGTATATTGGGTTCAGA
CTTGGGGGCAGAAGTTCAGACACACCGTGCTCAGGAGGGACCCAGAGCCGAGTTTCGGAG
TTTGGTAAAGTTTACAGGGTAGCTTCTGAAATTAACTCAAACTTTTGACCAAATGAGTGC
AGATTCTTGGATTCACTTGGTCACTGGGCTGCTGATGGTCAGCTCTGAGACAGTGGTTTG
AGAGCAGGCAGAACGGTCTTGGGACTTGTTTGACTTTCCCCTCCCTGGTGGCCACTCTTT
GCTCTGAAGCCCAGATTGGCAAGAGGAGCTGGTCCATTCCCCATTCATGGCACAGAGCAG
TGGCAGGGCCCAGCTAGCAGGCTCTTCTGGCCTCCTTGGCCTCATTCTCTGCATAGCCCT
CTGGGGATCCTGCCACCTGCCCTCTTACCCCGCCGTGGCTTATGGGGAGGAATGCATCAT
CTCACTTTTTTTTTTTAAGCAGATGATGGGATAACATGGACTGCTCAGTGGCCAGGTTAT
CAGTGGGGGGACTTAATTCTAATCTCATTCAAATGGAGACGCCCTCTGCAAAGGCCTGGC
AGGGGGAGGCACGTTTCATCTGTCAGCTCACTCCAGCTTCACAAATGTGCTGAGAGCATT
ACTGTGTAGCCTTTTCTTTGAAGACACACTCGGCTCTTCTCCACAGCAAGCGTCCAGGGC
AGATGGCAGAGGATCTGCCTCGGCGTCTGCAGGCGGGACCACGTCAGGGAGGGTTCCTTC
ATGTGTTCTCCCTGTGGGTCCTTGGACCTTTAGCCTTTTTCTTCCTTTGCAAAGGCCTTG
GGGGCACTGGCTGGGAGTCAGCAAGCGAGCACTTTATATCCCTTTGAGGGAAACCCTGAT
GACGCCACTGGGCCTCTTGGCGTCTGCCCTGCCCTCGCGGCTTCCCGCCGTGCCGCAGCG
TGCCCACGTGCCCACGCCCCACCAGCAGGCGGCTGTCCCGGAGGCCGTGGCCCGCTGGGA
CTGGCCGCCCCTCCCCAGCGTCCCAGGGCTCTGGTTCTGGAGGGCCACTTTGTCAAGGTG
TTTCAGTTTTTCTTTACTTCTTTTGAAAATCTGTTTGCAAGGGGAAGGACCATTTCGTAA
TGGTCTGACACAAAAGCAAGTTTGATTTTTGCAGCACTAGCAATGGACTTTGTTGTTTTT
CTTTTTGATCAGAACATTCCTTCTTTACTGGTCACAGCCACGTGCTCATTCCATTCTTCT
TTTTGTAGACTTTGGGCCCACGTGTTTTATGGGCATTGATACATATATAAATATATAGAT
ATAAATATATATGAATATATTTTTTTAAGTTTCCTACACCTGGAGGTTGCATGGACTGTA
CGACCGGCATGACTTTATATTGTATACAGATTTTGCACGCCAAACTCGGCAGCTTTGGGG
AAGAAGAAAAATGCCTTTCTGTTCCCCTCTCATGACATTTGCAGATACAAAAGATGGAAA
TTTTTCTGTAAAACAAAACCTTGAAGGAGAGGAGGGCGGGGAAGTTTGCGTCTTATTGAA
CTTATTCTTAAGAAATTGTACTTTTTATTGTAAGAAAAATAAAAAGGACTACTTAAACAT
TTGTCATATTAAGAAAAAAAGTTTATCTAGCACTTGTGACATACCAATAATAGAGTTTAT
TGTATTTATGTGGAAACAGTGTTTTAGGGAAACTACTCAGAATTCACAGTGAACTGCCTG
TCTCTCTCGAGTTGATTTGGAGGAATTTTGTTTTGTTTTGTTTTGTTTGTTTCCTTTTAT
CTCCTTCCACGGGCCAGGCGAGCGCCGCCCGCCCTCACTGGCCTTGTGACGGTTTATTCT
GATTGAGAACTGGGCGGACTCGAAAGAGTCCCCTTTTCCGCACAGCTGTGTTGACTTTTT
AATTACTTTTAGGTGATGTATGGCTAAGATTTCACTTTAAGCAGTCGTGAACTGTGCGAG
CACTGTGGTTTACAATTATACTTTGCATCGAAAGGAAACCATTTCTTCATTGTAACGAAG
CTGAGCGTGTTCTTAGCTCGGCCTCACTTTGTCTCTGGCATTGATTAAAAGTCTGCTATT
GAAAGAAAAAG
aaagcgaacagtttttgtttgttttttttgccgtgtgtgctccatagtggaggcgctatt
ttccaattgatgagaatgacaaacatatataatctatctatctatctatctatctatcta
tctatacagggggcttgaaccttactcacccaagagcttcttacggaatgtggtagaaaa